乌拉尔图小麦Viviparous－1基因的单倍型及其表达特性研究

刘思蒙，孙晓燕，刘世鑫，曲若端，王晓丽，杨 燕

（内蒙古农业大学 生命科学学院，呼和浩特010018）

Pre－harvest sprouting（PHS）of kernels while they are still in the ear occurs usually in response to damp conditions and is due to an early break of seed dormancy［1－3］．The Viviparous 1（Vp1）gene is an important regulator of late embryogenesis in maize［4］．Maize Vp1and Arabidopsis abi3mutants produced precociously germinating seeds［5－8］．Orthologs of Vp1have been identified in a number of species including OsVp1from rice［9］，PvAlffrom Phaseolus vulgaris［10］，AfVP1from wild oats［11］，ABI3from Arabidopsis［12］and PtABI3from poplar［13］．Three orthologous Vp1genes are present in bread wheat，which are located on the long arms of chromosomes 3A，3Band 3D，respectively［14］．The structure and expression of the three Vp1homologues in bread wheat have been determined，showing that each had the potential to encode a fulllength functional protein［15］．However，incorrect splicing of pre－mRNA leads to a diverse RNA population that in most cases encodes aberrant translation products．The transcript structures in ancestral and closely related species were also analyzed and it was suggested that mis－splicing of Vp1 genes originated before the evolution and domestication of bread wheat and contributes to susceptibility to PHS in modern hexaploid wheat varieties［15］．However，the expression level of Vp1 was determined in mature embryos of dormant and nondormant cultivars，indicating apositive correlation between Vp1expression level with seed dormancy and embryo sensitivity to ABA［16－17］．In wild oats（Avena fatua），the expression of AfVp1was controlled by the interaction between the environment and genotype，with a close correlation between AfVp1mRNA levels and seed dormancy being observed［11］．Transgenic wheat seeds expressing the AfVp1cDNA showed increased dormancy and tolerance to PHS［15］．

In previous studies，17novel TaVp－1A haplotypes were explored on chromosome 3A of bread wheat，which was located in three major regions such as the third intron，fifth intron and sixth exons［18］．Furthermore，five new alleles of TaVp－1A（the wild－type allele） on chromosome 3A（TaVp1Ab，TaVp1Ac，TaVp1Ad，TaVp1Ae and TaVp1Af）were identified from a set of CIMMYT wheat elite germplasm，which showed different responsiveness to ABA exposure［19］．Rich allelic variations were also demonstrated in T．monococcum（genomeAm），T．boeoticum （genome Am），T．durum （genomes A and B）and T．dicoccoides（genomes A and B）［20］．However，the haplotypes of Vp－1Ain T．urarturemain unclear．Therefore，investigation of Vp－1Ahaplotypes in T．urartuand identification of novel haplotypes conferring higher PHS resistance will provide more information about the origin and evolution of TaVp－1Aof common wheats，and benefit the improvement of the wheat for enhanced PHS resistance．

1 Materials and methods

1．1 Plant materials

Twenty spring Triticum urartuentries（Table 1）were used to characterize the Vp－1A haplotypes，which were kindly provided by Dr．Yueming Yan from the College of Life Sciences，Capital Normal University，Beijing，China．

1．2 Development of PCR primers and sequencing of PCR products

Gene－specific primers were developed based on the Vp－1A gene sequences of wheat［18－20］，except the primer setVp－1AF1／R1（Table 2）．PCR fragments were sequenced on both strands by Huada Gene Biological Technology Co．Ltd．（http：／／www．genomics．cn／index．php）．In order to diminish the sequencing errors of PCR products，the PCR reaction and sequencing of each sample were repeated for 3 times．The PCR products were cloned and sequenced using pMD19－T vector（TaKaRa）．Sequence analysis and characterization were performed by software DNAman （http：／／www．lynon．com）．

1．3 DNA extraction and PCR amplification

Genomic DNA was isolated from the seedlings samples using the method described by Gale et al［21］．PCR reactions were performed in an Applied Biosystems 2 720thermal cycler in a total volume of 15μL，including 3μL 5×CES，1．5μL 10×PCRbuffer，2．5 mmol／L of each dNTP，2．4pmol of each primer，0．6Uof TaKaRa Taq polymerase and 25ng of template DNA．The following conditions for PCR amplification were 94 ℃for 5 min，followed by 36cycles of 94℃for 1min，annealing for 1min and 72℃for 1min，with a final extension of 72 ℃for 10 min．Amplified PCR fragments were separated on a 12%denaturing polyacrylamide gel，as recommended by Bassamet al［22］．

Table 1 Polymorphisms of Vp－1AF1／R1，Vp－1AF2／R2and Vp－1AF4／R4primers from20 genotypes of T．uratu

1．4 ABA treatment

Mature embryos of the four cultivars，TuVp－1Abgi（Xs7449），TuVp－1Acgh（PI427328），TuVp－1Adfi（PI428255）and TuVp－1Aefi（PI428266），were isolated at dough stage 35days after pollination（DAP）under sterilized conditions and stratified on filter saturated with water or 30μmol／L ABA solution in the Petri dishes at 25℃in darkness for 1 ，2and 4d，respectively．The embryos were sampled for RNA extraction at the above time point．The embryos without any treatment were used as control．

1．5 RNA isolation and semi－quantitative RT－PCR analysis

Total RNA was extracted from embryos at dough－yellow ripening stage 35（DAP）following protocol described in TransZol Plant kit（Trans－Gen Biotech）．RNA concentration and quality were determined by spectrophotometer at 260nm and by the A260∶A280ratio，respectively．RNA integrity was assessed by comparing the relative intensities of the 28Sand 18SrRNA bands in 1．2% （W／V）agarose gels containing 2．2 mol／L formaldehyde．cDNA was synthesized from 5μg of the total RNA using M－MLV reverse transcriptase （TaKaRa）with random hexamer primer oligo d（T）19according to the manufacturer’s instructions．

RT－PCR primers and primers for wheat actin gene that was included as an internal control in each reaction to normalize the expression level of Vp1genes were listed in Table 2．Semi－quantitative RT－PCR reactions were performed in an Applied Biosystems 2720thermal cycler in a total volume of 25μL，including 5μL 5×CES，2．5μL 10×PCR buffer，1．25 mmol／L of each dNTP，4．0pmol of each primer，1．0 Uof TaKaRa LaTaq polymerase and 1μL of the cDNA template．The reaction conditions were 94 ℃for 5min，followed by 36cycles of 94 ℃for 1min，68 ℃for 1min，and 72 ℃for 1 min，with a final extension of 72℃for 10min．The RT－PCR products were separated on a 2．0%agarose gel．Values were normalized with the amplification rate of the actin gene as a constitutively expressed internal control．Three replicates were performed for each sample．

2 Results and analyses

2．1 Phylogenetic analyses

All the genomic DNA sequences of cloned Vp－1Agenes in this study，together with those of common wheat genes TaVp－1Aam，TaVp－1Aan，TaVp－1Aao，TaVp－1Abm，TaVp－1Abn，TaVp－1Agm，TaVp－1Ahm，TaVp－1Ahn，TaVp－1Aho，TaVp－1Aim，TaVp－1Ain，TaVp－1Aio，TaVp－1Ajm，TaVp－1Ajn，TaVp－1Akm，TaVp－1Alm，TaVp－1Aln，TaVp－1Aa，TaVp－1Ba，TaVp－1Bb，TaVp－1Bc，TaVp－1Bd，TaVp－1Be and TaVp1－D［17－20］，Vp1Ab，Vp1Ac，Vp1Ad，Vp1Ae and Vp1Af were identified from a set of CIMMYT wheat elite germplasm［19］，and TmVp1A1，Tm－Vp1A2，TmVp1A3，TbVp1A1，TbVp1A2，Tb－Vp1A3，TduVp1B1，TduVp1B2，AtVp1D1and At－Vp1D2 were identified from related species［20］，were used to construct the phylogenetic trees．Gene sequences were aligned with the software Cluster W1．83．Neighbor joining tree and Maximum likelihood tree were generated by the program MEGA version 6．0with 1 000replicates of bootstrap testing，in which gaps were excluded only from pairwise comparisons for the former algorithm，whereas all sites were used as characters for the latter one．

2．2 Amplification and sequence analysis of the Vp－1Ahomologues in T．urartu

Four primer sets covering the whole length of the Vp－1A genome sequence were designed and used for PCR amplification to detect the allelic variations．Based on the PCR amplification and sequencing analyses using 12%polyacrylamide gel electrophoresis（PAGE），3out of the 4regions covered by the primer sets（Vp－1AF1／R1，Vp－1AF2／R2and Vp－1AF4／R4）has polymorphism in the 20 genotypes studied（Fig．1）．

Fig．1 Polymorphism of PCR fragment amplified with the primer sets in 4 T．urartugenotypes A．Two kinds of fragments of 1 073bp and 1 065bp，amplified with the primer sets Vp－1AF1／R1，designated as letters I and H；B．Four kinds of fragments，amplified with the primer sets Vp－1AF2／R2，726bp（B），735bp（C），739bp（D）and 751bp（E），designated as letters of B，C，D and E respectively；C．Two kinds of fragments 1 214bp and 1 180bp，amplified with the primer sets Vp－1AF4／R4，designated as letters of F and G；The 4 genotypes for A and C were PI428244（1），PI428254（2），PI428255（3），PI427328（4），respectively．The 4genotypes were PI428244（1），PI428254（2），Xs7449（3），PI427328（4），respectively．

Two polymorphic fragments were detected from the 20 genotypes with the primer set Vp－1AF1／R1（Fig．1，A）．The 1 065 bp fragment marked with letter H was from PI 427328and the other（1 073bp，marked with letter I）was from the rest 19genotypes（Fig．1，A）．Compared with the wild type allele Vp－1 Aa（AJ 4 0 0 7 1 2），the H fragment had a 35 bp deletion（CCACTTGCAATTTTCAGCTATATATATGCATGCAT C），a 6 bp deletion（ATATGC），a 2bp insertion（CT），a 4 bp deletion（GCTA），a 1bp deletion（C）and 27 SNPs．In addition to a 1bp deletion and 5SNPs，the I fragment also had the same 35bp deletion as the H fragment（Table1，Fig．2）．Four different fragments（726bp，735bp，739bp and 751bp）were detected using the primer set Vp－1AF2／R2（Fig．1，B），they were marked with the letter B（726bp），C（735bp），D（739bp）and E（751bp），respectively （Fig．1，B）．Compared with the sequence of wild type allele Vp－1Aa in common wheat（AJ400712），the details of detected variants were described as following：B fragment had a 16 TTC deletion at position 2 746－2 793bp，a 1bp deletion at position 2 718bp，a 1bp insertion at position 2 860bp，and 9 SNPs between 2 341and 2 862bp；C had a 13TTC deletion at position 2 746－2 793bp，a 1bp insertion at position 2 860bp，a 1bp deletion at position 2 718bp，and 8SNPs between 2 341bp and 2 862bp；D had a 12TTC deletion at positions 2 746－2 793bp，a 1bp insertion at position 2 860bp and 6SNPs between 2 341and 2 873 bp；E had a 8 TTCs insertion at position 2 746－2 793bp and a 1bp insertion at position 2 860bp．In addition，in the fourth exon，D and E fragments each had a SNP at position 2 957bp（A to G）（Table1，Fig．2）．Blast against the TIGR plant repeat database（http：／／plantrepeats．plantbiology．msu．edu／index．html）showed that the 16 TTC repeats had 80．00%similarity with Zea mays CRM centromeric retrotranposon（E＝0．033），and 85．42% similarity with Oryza sativa clone noaCRR1＿CH10－3 noaCRR1retrotransposon （E ＝0．023），suggesting that it might be an important repeat sequence inside the retrotransposon and developed during the wheat evolution．

Two kinds of polymorphic fragments marked with the letter F（1 214bp）and G（1 180bp）respectively were detected in 20genotypes using the primer set Vp－1AF4／R4（Fig．1，C）．Sequence analysis showed that the F fragment was the same as the wild type allele Vp－1Aa（AJ400712），whereas the G fragment contained a 3bp deletion at position 3 202－3 204bp，a 31bp deletion at position 3 538－3 568bp，a 1bp deletion at 3 798bp in the fifth intron，and a 1bp insertion at downstream region of 4 263bp．The 31bp deletion itself had several exon－intron boundaries GT－AG，and might act as an intron（Table 1，Fig．2）．

Fig．2 Schematic representation of the diverse genetic structures of TuVp－1Ahaplotypes detected in this set of T．urartugermplasm ORFs were indicated by boxes and A1，B1，B2and B3domains by shaded squares．Other symbols representing deltions，insertions and SNPs were indicated as◆：SNPs；—▽：35bp deletion；＝▽：24bp deletion；▽：1bp deletion；＝▼：41bp deletion；—▼：2bp deletion；○：49bp deletion；△：1bp insertion；□：40bp deletion；—○：35bp deletion；▼：31bp deletion；＝△：3bp deletion，respectively．

Fig．3 Phylogenetic tree of the Vp－1gene families in common wheat and its related species The tree was constructed by the software MEGA version 6．0with neighbour joining and Maximum likelihood algorithm，including 4new haplotypes identified in this study and 40haplotypes identified in our previous study．Bootstrap values are shown and the scale bar indicates the number of nucleotide substitutions per site

In total，4novel haplotypes were detected in this set of 20 T．urartu germplasm，which were designated as TuVp－1Abgi，TuVp－1Acgh，TuVp－1Adfi and TuVp－1Aefi，respectively，according to the 2005 Supplement of the Wheat Gene Catalogue［23］（Table 1，Fig．2）．Among this set of germplasm，TuVp－1Adfi was the most common allele with a frequency of 55．0%，followed by TuVp－1Aefi，TuVp－1Abgi and TuVp1－Acgh which had the frequency of 35．0%，5．0%and 5．0%，respectively． Phylogenetic trees were generated based on different algorithms．The results of phylogenetic analysis indicated that the Vp1haplotypes from the genomes A，B and D were clustered in three different trees．The genome tribe for A，B and D genomes were further divided into three clusters．Vp－1A haplotypes from bread wheat had closer relationships with these from T．urartuthan from T．monococcum and T．boeoticum （Fig．3）．This suggested that a genome of all polyploidy wheats was indeed contributed by T．urarturather than by T．monococcum［24－25］．

2．3 Expression characterization of the explored novel Vp－1A haplotypes in T．urartu and their responses upon ABA treatment

Semi－quantitative RT－PCR was used to deter－mine the expression of the 4 haplotypes TuVp－1Abgi，TuVp－1Acgh，TuVp－1Adfi and TuVp－1Aefi in seed embryos at dough－yellow ripening stage treated with or without 30μmol／L ABA solution，to investigate the responsiveness of these haplotypes which harboring insertion or deletion in second，third and fifth introns to ABA treatment．The clearly mis－spliced transcripts were presented in the mature embryos of TuVp－1Adfi and TuVp－1Aefi treated with or without 30μmol／L ABA solution，but no mis－spliced transcript was detected in genotypes with TuVp－1Abgi and TuVp－1Acgh haplotypes（Fig．4）．

Fig．5 Semi－quantitative RT－PCR analysis of Vp－1A alleles in mature embryos without treatments M．DL2000；1．xs7449（TuVp－1Abgi）；2．PI428250（TuVp－1Adfi）；3．PI428262（TuVp－1Aefi）；4．PI427328（TuVp－1Acgh）

Differences in the expression levels of the correctly spliced transcripts in mature embryos of Tu－Vp－1Abgi （Xs7449），TuVp－1Acgh （PI427328），TuVp－1Adfi（PI428255and PI428250）and TuVp－1Aefi（PI428266and PI428262）were observed in the control（Fig．4and Fig．5）．Among them，the most abundance of correctly spliced transcripts was observed in PI428255and PI428250，while the least in Xs7449（Fig．4and Fig．5）．Upon water imbibition，the transcripts were different in the genotypes with these 4haplotypes，as the expression levels of Tu－Vp－1Adfi（PI428255）were reduced after imbibition in water at 1，2and 4dcompared with the mature seeds without water treatment（Fig．4），however，the expression levels of other haplotypes were significantly reduced，as that of TuVp－1Acgh（PI427328）reduced to below detectable levels after imbibed in water at 4d，while that of TuVp－1Abgi（Xs7449）was much lower in water at 1and 2d，while that of TuVp－1Aefi（PI428266）showed the most abundance in water at 2d，then decreased in 4d．

Upon ABA treatment，different expression profiles were observed among TuVp－1Abgi，TuVp－1Acgh，TuVp－1Adfi and TuVp－1Aefi haplotypes（Fig．4），and the statistical analysis showed that there were significantly differences among haplotypes on GR treated by ABA for 2and 4d，the haplotype of TuVp－1Abgi showed higher GR than that of the other haplotypes．The above resulted indicated that the differences in ABA response profiles due to the different haplotypes．The expression levels of TuVp－1Adfi after 1，2and 4dwere much higher than water stratification and that of other haplotypes under the same condition，showing its ABA hyper－sensitiveness，although the haplotypes of TuVp－1Abgi and TuVp－1Acgh also showed a relative increased expression levels after treated with 30μmol／L ABA solution for 1and 2 d，respectively．At the same time，the transcript levels of TuVp－1Aefi were increased after 2dupon ABA treatment，but decrease thereafter（Fig．4）．This result indicated that these 4haplotypes differed in responsiveness to ABA exposure．

3 Discussion

In our previous studies，17 Vp－1A haplotypes have been identified on 3Agenome of bread wheat，which was located in three major regions of third intron，fifth intron and sixth exon［18］，5 Vp－1Ahaplotypes on chromosome 3Aof CIMMYT elite bread wheat，3 Vp－1A haplotypes in T．monococcum which were designated as TmVp1A1，TmVp1A2 and TmVp1A3，and 3 Vp－1A haplotypes in T．Boeoticum designated as TbVp1A1，TbVp1A2and TbVp1A3［20］．In the present study，4novel Vp－1A haplotypes were identified in T．urartu，designated as TuVp－1Abgi，TuVp－1Acgh，TuVp－1Adfi and TuVp－1Aefi，respectively．These four allelic variations in third intron of Vp－1A were mainly caused by TTC repeats，including the 48－bp （16 TTCs）deletions B fragments，39－bp（13TTCs）deletion in C fragment，36bp（12 TTCs）deletion in D fragment and 24bp（8 TTCs）deletion in E frament from T．urartu．The 48bp deletion （16 TTCs），which existed in B fragments，found in common wheat［26］，and the 36－bp deletion（12TTCs），which existed in D（739bp）fragment，detected in wheatrelated species with AmAmgenome and common wheat（3TCTs＋1TCC＋12TTCs＋1T）［18，20］，while the fragments C （735bp）and E （751bp）were newly explored in this study．For all of these Vp1haplotypes，they shared the similarity that the third intron was the common polymorphic site with many CTT，TTC and TCT repeats．The change of simple sequence repeats（SSR）due to replication slippage during meiotic replication was caused by a temporary separation of the nascent from the template strand，followed by a misplaced realignment forming a loop，which lead to a change in the number of motif reiteration［27］．The inherited length changes in SSRs might slow the changes of physical properties，and reduce the risk of drastic mutations that might be lethal for the organism［28］．Therefore，SSRs often present high levels of interand intra－specific polymorphism，particularly when the tandem repeats reached to ten or more［19］．

Furthermore，the present study also found the polymorphic sites in second and fifth introns，as well as in the third intron．Among them，a 31－bp deletion（AGTTTTATGTCATGCATTTTTTTAGAAAAGG）was detected in the fifth intron from the allelic variations TuVp－1Abgi and TuVp－1Acgh，which also exsited in common wheat and CIMMYT elite bread wheat germplasm，but not in T．monococcum and T．boeoticum．Furthermore，phylogenetic trees analysis showed that haplotypes of Vp－1A of common wheat have closer relationship with T．urartu than T．monococcum．These lines of evidences further proved that T．urartu was the direct donor of A genome in common wheat［25，29－31］．However，a 134－bp deletion detected in the fifth intron of some common wheat varieties was not found either in T．monococcum and T．boeoticum［20］or this set of T．urartugermplasm，indicating that the 134－bp deletion did not origin from the related species，and might come from the variation of chromosome structure during the evolution．

So far，34 Vp－1A haplotypes such as TaVp－1Aam，TaVp－1Aan，TaVp－1Aao，TaVp－1Abm，TaVp－1Abn，TaVp－1Agm，TaVp－1Ahm，TaVp－1Ahn，TaVp－1Aho，TaVp－1Aim，TaVp－1Ain，TaVp－1Aio，TaVp－1Ajm，TaVp－1Ajn，TaVp－1Akm，TaVp－1Alm，TaVp－1Aln，Vp－1Aa，Vp－1Ab，Vp－1Ac，Vp－1Ad，Vp－1Ae，Vp－1Af，Vp1Ab，Vp1Ac，Vp1Ad，Vp1Ae，Vp1Af ，TbVp1A1 Tb－Vp1A2，TbVp1A3，TmVp1A1，TmVp1A2and Tm－Vp1A3were detected in common wheat in China，CIMMYT elite germplasm，and wheat related species T．monococcum and T．boeoticum showed different responsiveness to ABA［17－20，26，32］．Moreover，the polymorphic sites of TuVp－1Adfi，TuVp－1Aefi，TuVp－1Abgi and TuVp－1Acgh were mainly located in the second，third and fifth introns，which were the same locations as the haplotypes of Vp－1A detected in T．boeoticum and T．monococcum［20］，while in the haplotypes of Vp－1Ain common wheat，the polymorphic sites mainly located in third intron，fifth intron and sixth exon［18］．RTPCR analysis showed that different variations affected the expression level of transcripts，and the responsiveness to ABA．Therefore，differences in intron region might play a critical role in determining the functional performance［33－34］．For example，in mammalian cells，the expression of the beta globin gene is highly dependent on the presence of the intron；in the absence of the introns，3′end processing is inefficient and the level of both nuclear and cytoplasmic 3′end－processed RNA significantly decreased［23］．Another example is the important positive regulatory element included in the intron of MYHC（myosin heavy chain）gene：this regulatory element can up－regulate its endogenous or a heterologous muscle promoter in a position specific manner，and on its own drive a reporter gene［34］．

As described previously，in total 34 Vp－1A haplotypes were detected in common wheat in China，CIMMYT elite germplasm，and wheat related species T．monococcum and T．boeoticum［17－20，26，32］．However，although it was proposed that T．urartu is a strong potential donor of A genome of all polyploidy wheats［24－25］，only 2polymorphic loci of Vp－1Asuch as deletions of 16and 12TTC repeats presented in this set of T．urartugermplasm due to both the limited materials used in this study and more Vp－1Ahaplotypes may exist in T．urartu beyond this set of germplasm．Furthermore，phylogenetic trees analysis showed that haplotypes of Vp－1Aof common wheat have closer relationship with T．urartuthan T．monococcum，so this result in this study presented another evidence of origin and evolution of A genome of common wheat．

ABA plays important roles in the adaptation of vegetative tissue to abiotic environmental stresses such as drought and high salinity as well as in seed maturation and dormancy［35］．Maize VP1regu－late key aspects of plant seed development and ABA signaling［36］．Null allele Vp－1resulted in loss of ABA sensitivity，leading to non－dormancy or vivipary in maize．In our previous study，agenotype with the TaVp－1Bballele was the most sensitive to ABA treatment with transcript levels in mature embryos after two days exposure to ABA being higher than the other two alleles TaVp－1Bc and TaVp－1Ba，and genotype of TaVp－1Bb always have capacity of more strong dormancy than genotype of TaVp－1Bc and TaVp－1Ba［17－18］，these study clearly demonstrated that insertions and deletions in the TaVp－1B gene affects both its expression and seed dormancy，ABA sensitivity，and PHS tolerance，these result identical with that there was a positive correlation between the degree of seed dormancy，ABA sensitivity and the level of TaVp－1 transcripts in wheat mature embryos［16］．In this study，haplotypes of TuVp－1Adfi，TuVp－1Aefi，TuVp－1Abgi and TuVp－1Acgh differed in responsiveness to ABA exposure，and TuVp－1Adfi showed ABA hyper－sensitiveness and lower GI，these result showed that insertions and deletions in the TuVp－1A gene affects both its expression and seed dormancy，ABA sensitivity，and PHS tolerance．So genotype of TuVp－1Adfi might be useful in developing the synthetic wheats with improved PHS tolerance．

［1］ BEWLEY JD．Seed germination and dormancy［J］．Plant Cell，1997，9（7）：1 055－1 066．

［2］ LENTON J R．Opportunities for the manipulation of development of temperate cereals［J］．Advances Botanical Research，2011，34（1）：127－164．［3］ APPLES R，FRANCKI，CHIBBAR R．Advances in cereal functional genomics［J］．Functional ＆Integrative Genomics，2003，3（1）：1－24．

［4］ MCCARTY，D R，HATTORI T，CARSON C B，et al．The Viviparous－1developmental gene of maize encodes a novel transcriptional activator［J］．Cell，1991，66（5）：895－905．

［5］ KOORNNEEF M，REULING G，KARSSEN C M．The isolation and characterization of abscisic acid－insensitive mutants of Arabidopsis thaliana［J］．Physiologia Plantarum，1984，61（3）：377－383．

［6］ NEILL S J，HORGAN R，PARRY A D．The carotenoid and abscisic acid content of viviparous kernels and seedlings of Zea mays L［J］．Planta，1986，169（1）：87－96．

［7］ ROBICHAUD C S，SUSSEX I M．The response of viviparous1and wild－type embryosof Zea mays to culture in the presence of abscisic acid［J］．Journal of Plant Physiology，1986，126（2－3）：235－242．

［8］ CHONO M，HONDA I，SHINODA S，et al．Field studies on the regulation of abscisic acid content and germinability during grain development of barley：molecular and chemical analysis of pre－harvest sprouting［J］．Journal of Experimental Botany，2006，57（10）：2 421－2 434．

［9］ HATTORI T，TERADA T，HAMASUNA S T．Sequence and functional analysis of the rice gene homologous to maize Vp1［J］．Plant Molecular Biology，1994，24（5）：805－810．

［10］ BOBB A JEIBEN H GBUSTOS M M．PvAlf．An embryo－specific acidic transcriptional activator enhances gene expression from phaseolin and phytohemagglutinin promoters［J］．Plant Jornal，1995，8（3）：331－343．

［11］ JONES H D，PETERS N C，HOLDSWORTH．Genotype and environment interact to control dormancy and differential expression of the VIVIPAROUS 1homologue in embryos of Avena fatua［J］．Plant Journal，1997，12（4）：911－920．

［12］ GIRAUDAT J，HAUGE，B M，et al．Isolation of the Arabidopsis ABI3gene by positional cloning［J］．Plant Cell，1992，4（10）：1 251－1 261．

［13］ ROHDE A，ARDILES－DIAZ W，VAN MONTAGU M，et al．Isolation and expression analysis of an ABSCISIC ACID－INSENSITIVE 3（ABI3）homologue fromPopulus trichocarpa［J］．Journal of Experimental Botany，1998，49（323）：1 059－1 060．

［14］ BAILEY P C，MCKIBBIN R S，LENTON J R．Genetic map location for orthologous VP1genes in wheat and rice［J］．Theoretical and Applied Genetics，1999，98（2）：281－284．

［15］ MCKIBBIN R S，WILKINSON M D，BAILEY P C，et al．Transcripts of Vp－1homologues are misspliced in modern wheat and ancestral species［J］．Proceedings of the National Academy of Sciences，2002，99（15）：10 203－10 208．

［16］ NAKAMURA S，TOYAMA T．Isolation of a VP1homologue from wheat and analysis of its expression in embryos of dormant and nondormant cultivars［J］．Journal of Experimental Botany，2001，52（362）：875－876．

［17］ YANG Y，MA Y Z，XU Z S，et al．Isolation and characterization of Vp－1genes in wheat varieties with distinct pre－harvest sprouting tolerance and ABA sensitivity［J］．Journal of Experimental Botany，2007a，58（11）：2 863－2 871．

［18］ YANG Y，ZHANG C L，LIU S X，et al．Characterization of the rich haplotypes of Viviparous－1Ain Chinese wheats and development of a novel sequence－tagged site marker for pre－harvest sprouting resistance［J］．Molecular Breeding，2014，33（1）：75－88．

［19］ SUN Y W，JONES H D，YANG Y，et al．Haplotype analysis of Viviparous－1gene in CIMMYT elite bread wheat germplasm ［J］．Euphytica，2012a，186（1）：25－43．

［20］ SUN Y W，YANG Y，SHEWRY P R，et al．Isolation and characterization of Viviparous－1haplotypes in wheat related species［J］．Euphytica，2012b，188（1）：71－84．

［21］ GALE KR，MA W，ZHANG W，et al．Simple High－Throughput DNA Markers for Genotyping in Wheat［M］／／EASTWOOD R，et al．10thAustralian Wheat Breeding Assembly Proceedings，2001：26－31．

［22］ BASSAM B J，CAETANO－ANOLLES G，GRESSHOFF P M．Fast and sensitive sliver staining of DNA in polyacrylamide gels［J］．Analytical Chemistry，1991，196（1）：80－83．

［23］ MCINTOSH R A，Devos K M，DUBCOVSKY J，et al．Catalogue of gene symbols for wheat：2005supplement，published online at：http：／／wheat．pw．usda．gov／ggpages／wgc／2005upd．html．

［24］ DVORÀK J，TERLIZZI P，ZHANG H B，et al．The evolution of polyploidy wheats：identification of the A genome donor species［J］．Genome，1993，36（1）：21－31．

［25］ HUANG S，SIRIKHACHORNKIT，A，Su X，et al．Genes encoding plastid acetyl－CoA carboxy－lase and 3－phosphoglycerate kinase of the Triticum／Aegilops complex and the evolutionary history of polyploidy wheat［J］．Proceedings of the National Academy of Sciences，2002，99（12）：8 133－8 138．

［26］ CHANG C，ZHANG H P，ZHAO Q X，et al．Rich allelic variations of Viviparous－1Aand their associations with seed dormancy／pre－harvest sprouting of common wheat［J］．Euphytica，2011，179（2）：343－353．

［27］ TAUTZ D，SCHLOTTERER C．Simple sequences［J］．Current Opinion in Hematology，1994，4（6）：832－837．

［28］ KING D G，SOLLER M，KASHI Y．Evolutionary tuning knobs［J］．Endeavor，1997，21（1）：36－40．

［29］ FEUILLET C，PENGER A，et al．Molecular evolution of receptor－like kinase genes in hexaploid wheat．Independent evolution of orthologs after polyploidization and mechanisms of local rearrangements at paralogous loci1［J］．Plant Physiology，2001，125（3）：1 304－1 313．

［30］ GU Y Q，COLEMAN－DERR D，KONG D，et al．Rapid genome evolution revealed by comparative sequence analysis of orthologous regions from four Triticeae genomes［J］．Plant Physiology，2004，135（1）：459－470．

［31］ PETERSEN G，SEBERG O，YDE M，et al．Phylogenetic relationships of Triticumand Aegilops and evidence for the origin of the A，B，and D genomes of common wheat（Triticum aestivum）［J］．Molecular Phylogenetics and Evolution，2006，39（1）：70－82．

［32］ YANG Y，ZHAO X L，XIA L Q，et al．Development and validation of a Vp－1STS marker for pre－harvest sprouting in Chinese wheats［J］．Theoretical and Applied Genetics，2007b，115（7）：971－980．

［33］ LU S，CULLEN B R．Analysis of the stimulatory effect of splicing on mRNA production and utilization in mammalian cells［J］．RNA，2003，9（5）：618－630．

［34］ CHANG，K C．Critical regulatory domains in intron 2of a porcine sarcomeric myosin heavy chain gene［J］．Journal of Muscle Research and Cell Motility，2000，21（5）：451－461．

［35］ NAKASHIMA K，FUJITA Y，KATSURA K，et al．Transcriptional regulation of ABI3－and ABA－responsive genes．including RD29Band RD29Ain seeds，germinating embryos and seedlings of Arabidopsis［J］．Plant Molecular Biology，2006，60（1）：50－68．

［36］ SUZUKI M，KETTERLING M G，LI Q B，et al．Viviparous1alters global gene expression patterns through regulation of abscisic acid signaling［J］．Plant Physiology，2003，132（3）：1 664－1 677．