Macrophage-derived exosomes mediate mir-222 targeting Caspase-10 to promote glioma proliferation

ZHENG Zhong-tao, ZHU Ye, LIU Xiao-qiang, WANG Chuang

1. Department of Neurosurgery, Haikou People's Hospital, Haikou 570208, China

2. Department of Clinical Psychology, Haikou People's Hospital, Haikou 570208, China

3. Department of Neurosurgery, Wanning People's Hospital, Wanning 571500, China

Keywords:

ABSTRACT Objective: To investigate whether macrophage-derived exosomal mir-222 regulates Caspase-10 and whether macrophage-derived exosomes promote glioma proliferation by targeting Caspase-10 through mir-222.Methods: Macrophages were transfected with mir-222 mimics,and then macrophage-derived exosomes carrying mir-222 were transfected into glioma cells.Caspase-10 overexpression vector was constructed on this basis.RT-PCR was used to detect mir-222 expression in macrophages and glioma cells.CCK-8 assay was used to detect the proliferative activity of glioma cells.Dual-luciferase reporter assay was used to verify the targeting binding of mir-222 with Caspase-10 gene.Western blot was used to detect Caspase-10 expression.Results: Transmission electron microscopy showed that macrophagederived exosomes had spherical structures with a diameter of about 100 nm; mir-222 mimic significantly promoted the expression of mir-222 in macrophages; macrophage-derived exosomal mir-222 increased mir-222 expression and promoted proliferation in glioma cells;mir-222 could target bind with Caspase-10; mir-222 mimic significantly inhibited Caspase-10 expression.Conclusion: Macrohpage-derived exosomal mir-222 plays an important role in promoting glioma proliferation by downregulating Caspase-10 expression through targeted binding.

1.Introduction

Glioma is the most common type of malignant tumor in the brain, accounting for up to 75% of all primary malignant brain tumors[1].The five-year survival rate for this type of tumor is approximately 36%.Patients’ primary symptoms include headaches,nausea, vomiting, and epileptic seizures, with severe patients more likely to have significant cognitive impairments[2].Gliomas, with their strong invasiveness and diffusion characteristics, damage surrounding normal brain tissue, hence significantly threatening the health of patients[3].Despite the existence of treatments such as surgical resection, radiation and chemotherapy, targeted and immunotherapy [4, 5], the overall survival period of all types of glioma patients has not significantly improved[6].In recent years,tumor vaccines such as peptide vaccines[7], and cell therapies such as CAR-T cell therapies[8] have been involved in clinical trials,bringing hope to the treatment of refractory gliomas.However,gliomas have a low sensitivity to immunotherapy and a stable immunosuppressive microenvironment, which are important reasons for the limited effect of immunotherapy[9].Moreover, the high cost of immunotherapy greatly limits the clinical benefits for patients.

In the tumour microenvironment, tumour-associated macrophages and microglia account for 50% of the total cell components of glioma, which can promote the progression of glioma and are closely related to the poor prognosis of patients[10].Extracellular vesicles (exosomes) are tiny vesicles constructed by the lipid bilayer ranging from 30 to 200 nanometers[11], These vesicles secreted from various cells function in transmitting proteins, nucleic acids, and other necessary metabolic substances amongst cells[12].Tumour cells can release exosomes into the tumour microenvironment to regulate tumour growth, invasion, and resistance to immunotherapy[13].This study will explore the role of exosomes generated by macrophages in promoting glioma proliferation.MicroRNAs (miRNA) belong to a family of non-coding RNAs[14], and the imbalance of miRNA may affect various characteristics of cancer, including proliferation,inhibition of cell death, promotion of invasion, and metastasis[15].In particular, miR-222 plays a crucial role in regulating the proliferation and aggressiveness of tumour cells, including glioma[16, 17].Furthermore, caspase-10, a member of the cysteine-aspartic acid protease (Caspase) family, plays a critical role in driving cell apoptosis (programmed cell death)[18].

This study transfects glioma cells with macrophage-derived exosomes expressing miR-222 to confirm the effect of miR-222 overexpression on glioma cell proliferation.Next, we validated that the macrophage-derived exosome miR-222 targets for the suppression of caspase-10 expression, a scenario that has not been reported yet.This mechanism will assist in elucidating the reasons for glioma proliferation and provide crucial groundwork for the future development of novel therapeutic approaches against glioma.

2.Materials and Methods

2.1 Experimental Materials and Main Instruments

The THP-1 human monocytes and U251 glioma cells were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences.The mir-222 primer, mir-222 mimic, and mimic negative control (NC) were purchased from the Shanghai Jima Company.The GAPDH antibody (ab8245) and caspase-10 antibody(ab177475) were purchased from Abcam.Over-expressing caspase-10 lentivirus (CH876545) was obtained from Vigene Biosciences.Trizol reagent was procured from Invitrogen (15596-026).The CCK8 kit was purchased from Beijing Quanshijin Bio-Tech Co.,Ltd (FC101-03) and the Dual-Luciferase reporter assay system from Promega (16186).The RNA extraction kit was sourced from Tianjin Biochemical Technology Co., Ltd.Reverse transcription kit was purchased from Toyobo (fsq-101).The RPMI 1640 culture medium and T75 cell culture flasks were purchased from Thermo Fisher(11875176, 156340 respectively).Lipo3000, PMA, PBS, and DEPCtreated water were purchased from Thermo Fischer (L3000015,00-4975-93, 70013032, and AM9906 respectively).Transmission electron microscope was obtained from JEOL, Japan (JEM-2100).The CO2 incubator was purchased from Thermo Fisher (3111).The microplate reader was supplied by the Shanghai Shanshuo Biotech Co., Ltd (ReadMax 1200).

2.2 Experimental Methods

2.2.1 Macrophage Induction

Initially, THP-1 cells were cultivated in RPMI 1640 medium with 10% fetal bovine serum in an environment of 37 ℃ and 5% CO2.When the cell proliferation reached a density of 1×106cells/mL,the cells were inoculated at a density of 3×106cells/bottle in T75 cell culture flask, with 100 nM PMA added and further cultivated under the conditions of 37 ℃, 5% CO2for 48 hours to induce the differentiation of THP-1 cells into macrophage-like cells.After induction, the cells were washed 1-2 times with PBS to remove any residual PMA.Subsequently, the cells were transferred into fresh RPMI 1640 medium and continued their cultivation for 24 h to allow cells to restore their normal physiological state.

2.2.2 Transfection of macrophages with miR-222 mimic

Initially, 6 μl of Lipo3000 reagent was added to each 1 ml of RPMI 1640 culture medium, followed by gentle flicking to ensure homogeneous mixing.In parallel, a transfection mixture was prepared by combining 2 ml of RPMI 1640 culture medium with 3 μl of miR-222 mimic or miR-222 mimic negative control (NC).This mixture was then thoroughly mixed with the Lipo3000 mixture and incubated at room temperature for 20 min.Subsequently, the culture was continued for 48 h under conditions of 37 ℃, 5% CO2.During this process, the Lipo3000 facilitated the translocation of the miR-222 mimic or the miR-222 mimic NC into the macrophages.

2.2.3 RT-PCR Detection

48 h following the transfection of macrophages with miR-222 mimic, total RNA from the macrophages was extracted using phenol-chloroform method.The cells were initially lysed using TRIzol, followed by phase separation with the addition of 200 μL of chloroform.The supernatant was subsequently extracted and mixed with isopropanol for RNA precipitation.After washing with 75% ethanol, the RNA was resuspended in DEPC-treated water and total RNA further extracted using an RNA extraction kit.The quality and purity of the extracted miRNA were assessed via gel electrophoresis.To procure cDNA, 1 μg of RNA was subjected to reverse transcription, and the resulting cDNA stored at -20 ℃ until use.

The TIANScript II cDNA First Strand Synthesis Kit (Tiangen Biotech Co., Ltd.) was used for mRNA reverse transcription, while the miRcute miRNA cDNA First Strand Synthesis Kit (Tiangen Biotech Co., Ltd.) was used for miRNA reverse transcription,incubating for 30 minutes at 55 ℃.The SuperReal PreMix (SYBR Green) RT-qPCR Kit (Tiangen Biotech Co., Ltd.) was employed to determine caspase-10 mRNA expression levels, using GAPDH as the internal reference.The reaction mixture (20 μL) consisted of 10 μL SYBR Premix EXTaq, 0.5 μL of forward primer, 0.5 μL of reverse primer, 2 μL of cDNA, and 7 μL of ddH20.The following cycling conditions were adopted: initial denaturation at 95 ℃ for 30 seconds;39 cycles of denaturation at 95 ℃ for 10 seconds, annealing at 60℃ for 30 seconds, and elongation at 72 ℃ for 15 seconds; followed by a final elongation step at 72 ℃ for 5 minutes.Expression of caspase-10 mRNA relative to GAPDH or of mir-222 relative to U6 was determined using the 2-ΔΔCtmethod.Each sample was tested in triplicates.The primer sequences are as follows: U6 forward:5’- CGCTTCGGCAGCACATATACCAGCACACATAAC-3’, U6 reverse: 5’- CAGGGGCCATGCTAATCTTCAGGCCATGCTAATC TTT-3’; mir-222 forward: 5’- CGCAGCTACATCTGGCTACTG-3’,mir-222 reverse: GTGCAGGGTCCGAGGT; GAPDH forward: 5’-CCAGGTGGTCTCCTCTGA-3’, GAPDH reverse:GCTGTAGCCAAATCGTTGT-3’; caspase-10 forward: 5’-GGCTATGTATCCTTTCGGCA-3’ and caspase-10 reverse:CCCTGTTTGTCCACTCTTCG.

2.2.4 Acquisition of Exosomes

The supernatant from the cultured macrophages was collected and filtered using a 0.22 μm filter.Following filtration to remove contaminants, the mixture was subjected to high-speed centrifugation at 10,000 g for 2 hours at 4 ℃.The supernatant was then discarded,and the pellet was washed with phosphate-buffered saline (PBS)and re-centrifuged at 10,000 g for an additional hour at 4 ℃.After centrifugation, the supernatant was removed, and the pellet was suspended again in PBS.The resulting exosomes were collected and set aside for subsequent experiments.

2.2.5 Observing Exosomes Under a Transmission Electron Microscope

The prepared exosomes were diluted with PBS, and 10 μL of the sample was dropped onto the grid sample holder of a transmission electron microscope, left for 2 min to allow the sample to absorb.Excess liquid was then soaked up with filter paper and left to dry naturally.Once the sample had dried, it was stained by adding 10 μL of uranyl acetate staining solution, protected from light for 30 seconds, and excess staining liquid was removed with filter paper and left to dry naturally.Lastly, the characteristics of the exosomes were observed and recorded through a transmission electron microscope.

2.2.6 Construction of Caspase-10 Expression Vector and Detection

U251 glioma cells in good growth status were inoculated into a 96-well plate at a density of 104cells per well, and 10 μL of Caspase-10 over-expressing lentivirus was added to each well.Glioma cells expressing Caspase-10 were obtained after a 24-h infection.The cells were then screened using puromycin to acquire glioma cells stably overexpressing Caspase-10.MiR-222 exosome suspension was then added to the culture medium of the Caspase-10-expressing glioma cells.The plate was gently shaken to ensure complete contact between the miR-222 exosomes and the glioma cells and was subsequently cultured for 48 hours.Finally, follow-up analyses were conducted, including RT-PCR to measure the expression levels of mir-222 and Caspase-10 RNA, and Western blot to detect Caspase-10 protein expression in the treated cells.

2.2.7 CCK-8 Assay

U251 glioma cells in the logarithmic growth phase were selected and planted in a 96-well plate at a density of 1 104 cells per well,and the plate was then incubated in a 37 ℃ constant temperature incubator.On the 2nd, 3rd, 4th, and 5th days of cell culture, 10 μL of the CCK-8 solution was added to each well, and the optical density(OD) at 450 nM was measured with a microplate reader.The OD450 value represents the cell proliferation level.Once the experiment was complete, the data were processed and a growth curve was plotted.

2.2.8 Database Prediction and Dual-luciferase Assay

The Targetscan database was used to predict the binding site of miR-222 in the 3’UTR region of Caspase-10.Based on the binding site, the wild-type and mutant sequences of the Caspase-10 3’UTR region were designed and inserted into the dual-luciferase vector.The mir-222 mimic and negative control, NC, were transfected into U251 glioma cells and, after 48 h of transfection, the luciferase activity was measured.First, 200 μL of lysis buffer per well was added to the U251 glioma cell culture dish, and the cells were lysed by incubating at 4 ℃ for 5 min.Then, 20 μL of the cell lysate was transferred to a luminescent plate, combined with 100 μL of firefly luciferase reaction solution, mixed gently, and measured for firefly luciferase activity on a luminometer.Then, 100 μL of renilla luciferase reaction solution was added, mixed, and the renilla luciferase activity was measured with a luminometer.

2.2.9 Statistical Analysis

GraphPad Prism 7.0 was used for statistical analysis and plotting of experimental data.T-tests or one-way analysis of variance (ANOVA)were used for comparison between groups.All experiments were independently repeated three times, and the measurement data were expressed in mean ± standard deviation (mean ± SD).A p value less than 0.05 was considered statistically significant, a p value less than 0.01 was considered to be of significant statistical difference,and a p value greater than 0.05 was considered to have no statistical difference.

3.Results

3.1 mir-222 mimic promotes the expression of mir-222 in macrophages

The relative abundance of mir-222 in macrophages was determined using qRT-PCR.The relative expression of mir-222 in the treatment group (3.54±0.67) was significantly higher than the control group(1.04±0.80) (t=6.43, P=0.003＜0.01), as shown in Figure 1.This indicates that the mir-222 mimic was successfully transfected into the macrophages, and that it promoted the expression of mir-222 in the macrophages.

Fig 1 mir-222 mimic promotes the expression of mir-222 in macrophages; **means P＜0.01

3.2 Macrophage-derived exosome mir-222 promotes U251 glioma cell proliferation

Transmission electron microscopy revealed that the experimentally obtained macrophage-derived exosomes presented a “concave”spherical vesicle structure (see Figure 2A), with a diameter of approximately 100 nm, consistent with exosome characterization.Thus, the isolated exosomes could be used in subsequent experiments.

qRT-PCR was used to determine the relative expression of mir-222 in U251 glioma cells.The relative expression of exo-mir-222 in the treatment group (2.45±0.14) was significantly higher than the control group (1.07±0.06) (t=15.39,P＜0.001), as shown in Figure 2B.This indicates that the obtained mir-222 exosomes successfully transfected U251 glioma cells and promoted the expression of mir-222 in U251 glioma cells.

The effect of exosome-derived mir-222 from treated macrophages on U251 glioma cells was assessed by assessing the proliferation of U251 glioma cells using the CCK-8 assay.On the fifth day, the OD450 value of the exo-mir-222 mimic group of U251 glioma cells(2.54±0.17) was significantly higher than the blank control group(1.70±0.23) (t=13.67,P＜0.001), as shown in Figure 2C.These results suggest that the high expression of mir-222 in U251 glioma cells promotes the proliferation of glioma cells.

Fig 2 Macrophage-derived exosomes promote the expression of mir-222 and enhance the proliferation of U251 glioma cells

3.3 mir-222 mimic promotes the expression and proliferation of mir-222 in U251 glioma cells

To exclude the effect of other substances in the exosomes derived from the treated macrophages, U251 glioma cells were separately transfected with mir-222 mimic for analysis.By qRT-PCR, the relative expression of mir-222 in U251 glioma cells was found to be significantly higher in the treatment group (3.42±0.45) than in the control group (1.10±0.01) (t=8.96, P＜0.001), as shown in Figure 3A.To determine the effect of mir-222 mimic on U251 glioma cells, the CCK-8 assay was used to detect the proliferation of U251 glioma cells.On the fifth day, OD450 values of the mir-222 mimic group of U251 glioma cells (2.73±0.18) were significantly higher than the control group (1.60±0.12) (t=11.54,P＜0.001), as shown in Figure 3B.These results suggested that mir-222 mimic can upregulate the expression of mir-222 in U251 glioma cells and promote their proliferation.

Fig 3 High expression of mir-222 promotes proliferation of U251 glioma cells

3.4 mir-222 targets and inhibits the expression of Caspase-10 in U251 glioma cells

qRT-PCR was again used to assess the relative expression of Caspase-10 in U251 glioma cells.The relative expression of Caspase-10 in the treatment group (0.33±0.01) was significantly lower than in the control group (1.05±0.12) (t=10.66, P＜0.001),as shown in Figure 4A.Western blot analysis revealed that the expression of Caspase-10 in the mir-222 mimic group (0.15±0.02)was significantly lower than in the NC group (0.45±0.03) (t=13.74,P＜0.001), as illustrated in Figure 4B.

The Targetscan database predicts that mir-222 binds with Caspase-10, and the binding site is shown in Figure 4C.Dual-luciferase assay results (Figure 4D) show that the luminescence intensity of the Caspase-10-WT+miR-222 group (0.38±0.02) was significantly lower than the NC group (1.00±0.05) (t=20.61, P＜0.001), while no significant difference was found between the Caspase-10-MUT+miR-222 group luminescence intensity (0.93±0.02) and the NC group (1.00±0.03) (t=2.78, P=0.05).This confirms that mir-222 has a targeted regulatory effect on Caspase-10, and that high expression of mir-222 in U251 glioma cells can target and suppress mRNA and protein expression of Caspase-10.

Fig 4 Mir-222 targets and inhibits the expression of caspase-10 in glioma cells

4.Discussion

Glioma, known for its high level of invasiveness and recurrence,is one of the most difficult-to-treat tumors in the field of neurology.The lack of key stimulatory factors in the glioma microenvironment poses major challenges to immunotherapeutic strategies.Macrophages play an immunosuppressive role in this context and may be partly to blame for glioma’s aggressive and hard-to-treat nature[9].Among other things, exosomes can cross the blood-brain barrier and alter the tumor microenvironment, thus further promoting tumor development[19].In addition, microRNAs (miRNAs) play pivotal roles in disease progression[20], and they can be transported across the blood-brain barrier, highlighting their important potential and research value in glioma treatment[21].mir-222 has been studied in various human tumors, and research results suggest that mir-222 overexpression promotes tumor invasion and metastasis[14].This phenomenon has been confirmed in cases of multiple myeloma [22],glioblastoma[23], bladder cancer[24] etc., in which patients with mir-222 overexpression experienced a higher risk of recurrence and faster progression after treatment.These findings demonstrate the regulatory role of mir-222 in the tumor microenvironment, thus opening up new pathways for innovative treatment strategies.

In our experiments, whether glioma cells are treated with exosomes from macrophages expressing mir-222 or directly treated with mir-222 mimic, results consistently showed high expression of mir-222.The significantly elevated OD450 values compared to the control group confirm an increase in glioma cell proliferation, suggesting that mir-222 plays a crucial role in this process.As observed in various types of cancer such as gliomas[25], breast cancer[26],pancreatic cancer[27], and liver cancer[28] an increasing number of studies show that exosomal miRNAs play pivotal roles in tumor cell growth.

Research has shown that Caspase-10 plays a critical role in tumor cell growth.Specifically, when tumor cells experience growth suppression, such as in prostate cancer cells, Caspase-10 expression levels increase correspondingly[29].However, studies demonstrate that in tumor tissue samples where Caspase-10 is knocked out, cell proliferation rate significantly quickens[30].On the other hand, myeloma cells can utilize Caspase-10 to suppress their autophagy process, which potentially allows them to evade cell death[31].Therefore, a reduction in Caspase-10 expression might trigger autophagic cell death in tumor cells[32].In our experiment,we confirmed that the 3’UTR is the binding site for mir-222 and Caspase-10, and further verified the regulatory effect of macrophagederived exosomal mir-222 on Caspase-10 in a dual-luciferase assay.Notably, glioma cells with overexpressed mir-222 showed a significant reduction in Caspase-10 expression.This phenomenon suggests that mir-222 targets and inhibits the expression of Caspase-10.Studies suggest that Caspase-10 might suppress tumor development by affecting metabolic mechanisms[30].Therefore, we speculate that the mir-222/Caspase-10 signaling pathway could become a new anti-cancer strategy.Further in-depth research is still needed on how the mir-222/Caspase-10 signaling pathway specifically impacts glioma cell growth.

In glioma patients, immune infiltrating cells, including macrophages, can promote angiogenesis, support tumor growth and metastasis, thus further exacerbating the condition[33].Recent research has found that exosomal mir-519a-3p promotes tumor cell metastasis by inducing macrophage-mediated angiogenesis,confirming that tumor cells can utilize macrophages and their secreted proteinases, among others, to promote metastasis,thereby enhancing their invasiveness and metastatic potential[34].Our previous research indicated that mir-222 is significantly overexpressed in the serum of glioma patients and is enriched in macrophage exosomes.Predictions made using the Targetscan database revealed potential binding sites for mir-222 and Caspase-10.We further verified that overexpression of mir-222 in macrophage exosomes can target and downregulate Caspase-10, thereby promoting the growth of glioma cells.However, as this experiment is based solely on in vitro cell models, which cannot fully simulate the complex environment within an organism, this conclusion needs further validation from future animal experiments.

Overall, our research has preliminarily explored how macrophagederived exosomes promote the growth of glioma cells by overexpressing mir-222 and specifically targeting and inhibiting the expression of Caspase-10.This discovery could potentially provide new insights into the pathogenesis of gliomas in the future and facilitate the development of new treatment strategies and targets for gliomas.

All authors declare that they have no conflicts of interest and consent to the submission of this manuscript.

Authors’ contributions

Zhongtao Zheng: Project design, financial support, manuscript writing

Ye Zhu: Experimental guidance, manuscript revisions

Xiaoqiang Liu: Cell culture, cell treatments

Chuang Wang: Cell assays, statistical analysis