Amplification and Bioinformatics Analysis of h-ns Gene of Vibrio alginolyticus

Ying CHEN, Shi WANG, Liangchuan CHEN, Haiyun FENG, Junlin WANG, Huanying PANG*, Na WANG

1. Fisheries College, Guangdong Ocean University, Zhanjiang 524025, China; 2. Guangdong Provincial Key Laboratory of Aquatic Animal Disease Control and Healthy Culture &Key Laboratory of Control for Diseases of Aquatic Economic Animals of Guangdong Higher Education Institutes, Zhanjiang 524025, China; 3. Chinese Academy of Inspection and Quarantine, Beijing 100176, China

Abstract [Objectives] To amplify the h-ns gene of Vibrio alginolyticus and analyze it by bioinformatics. [Methods] According to the h-ns gene sequence of V. alginolyticus HY9901, a pair of specific primers were designed and amplified by PCR. [Results] The h-ns gene was 408 bp in length and 135 amino acids were encoded. The predicted theoretical protein molecular weight was about 14.98 kD, and the isoelectric point was 4.99. Protein subcellular localization, SignalP 5.0, TMHMM Server 2.0 and SoftBerry-Psite predictions showed that H-NS was located outside the cell membrane, and the protein was unstable and hydrophobic. There was no signal peptide cleavage site, no transmembrane region and no KEGG metabolic pathway. The amino acid sequence contained three phosphorylation sites, one N-terminal myristoylation site and three microsomal C-terminal target signal sites. Using MEGA 5.0, H-NS phylogenetic tree was constructed by ortho-connection method. The results showed that H-NS of V. alginolyticus was closer to H-NS of Vibrio diabolicus. Using SWISS-MODEL, the three-dimensional structure model of H-NS subunit was simulated, which was similar to the crystal structure of Salmonella typhimurium H-NS1-83. [Conclusions] This study lays a foundation for exploring the regulation mechanism of V. alginolyticus H-NS protein on bacterial virulence in the future.

Key words Vibrio alginolyticus, Gene cloning, H-NS, Bioinformatics analysis

1 Introduction

Vibrioalginolyticus, as a kind of halophilic gram-negativebrevibacterium, is widely distributed in marine and estuarine water environment[1]. It can cause vibriosis, lead to a large number of deaths of marine animals such as fish, shrimp and shellfish, and cause serious economic losses. As a zoonotic bacterium, it can also cause human fulminant food poisoning[2], diarrhea[3], otitis media[4]and other diseases. The pathogenic process ofV.alginolyticusto the host includes adsorption, invasion, proliferation in vivo, toxin production and other steps. By resisting the host defense function,V.alginolyticusproduces pathogenic factors, thus damaging the host cells and interfering with cell metabolism[5]. In addition, the pathogenic process ofV.alginolyticusis also regulated by adhesion, secretion, iron uptake, density sensing and other systems[6].

At present, the main control method ofV.alginolyticusis to use antibiotics, but the long-term use of antibiotics will not only enhance the drug resistance ofV.alginolyticus, but also affect the quality and ecological safety of aquatic products[7]. The extensive use of antibiotics not only promotes the formation of bacterial drug resistance, but also brings adaptive costs to host bacteria. At present, it has been proved that H-NS protein can regulate the fitness cost of drug resistance of some bacteria[8]. It forms homodimer or heterodimer by itself, and combines with bent DNA sequence rich in AT base to form DNA-H-NS complex, thus inhibiting gene transcription and expression[9].

H-NS protein is a pleiotropic gene regulation inhibitor, which plays an important role in the adaptation and toxicity regulation of pathogenic bacteria such asEscherichiacoliandSalmonella[9]. As early as 2004, H-NS protein inE.coliwas proved to inhibit the expression of regulatory genestraMandtraJin F plasmid after the bacteria entered stable stage[10]. In 2020, studies proved that the H-NS protein encoded by plasmid could not only enhance the virulence of host bacteria, but also inhibit the expression of genes such as plasmid conjugation and isolation[11]. InSalmonellatyphimurium, it has been proved that H-NS protein can affect the motility of bacteria by controlling the expression of flagella[12].

In addition toE.coliandSalmonella, H-NS protein also plays a crucial role in regulation of various vibrios. Zhang Quanyietal.[13]found that H-NS ofVibrioparahaemolyticuscould directly inhibit the transcription ofexsA,exsCandexsD, thus inhibiting the expression of T3SS1, and negatively regulate the transcription of T3SS1 outer membrane protein genevp1667by inhibiting the expression of ExsA-ExsC-ExsD. In addition, H-NS can inhibit the transcription of other virulence factors including T3SS2, TDH and T6SS2[14]. InVibriocholerae, H-NS can inhibit the transcription of hapA gene, tcp and ctx operons[14]. But up to now, the related research onV.alginolyticusH-NS has not been reported. In this study, theh-nsgene ofV.alginolyticuswas cloned, and its amino acid sequence characteristics and subunit structure were analyzed in detail, which laid a foundation for the next study on the regulation mechanism of its protein on bacterial virulence.

2 Materials and Methods

2.1 Materials

2.1.1Vectors and strains.V.alginolyticusHY9901 was provided by Disease Laboratory of Guangdong Ocean University[15]; the cloning vector pMD18-T was purchased from Takara.

2.1.2Main reagents.ExTaqDNA polymerase was purchased from Takara; bacterial genomic DNA extraction kit and DNA gel recovery kit were purchased from Tiangen Co., Ltd.; PCR primer synthesis and sequencing were completed by Shanghai Sangon Biotechnology Service Co., Ltd.; ampicillin (Amp) (100 μg/mL) was purchased from Shanghai Sangon Biological Co., Ltd.; other reagents (imported or domestic) were analytically pure.

2.2 Methods

2.2.1Extraction of total DNA fromV.alginolyticusHY9901.V.alginolyticuswas coated on TSA plate, single colony was selected and inoculated in TSB medium, cultured by shaking at 28 ℃ for more than 12 h. The right amount of bacterial liquid was collected in 1.5 mL EP centrifuge tube and centrifuged for 2 min at 5 000 rpm/min before the bacteria were collected. Genomic DNA was extracted according to the instructions of the kit and stored at -20 ℃.

2.2.2Cloning ofh-nsgene. According to theh-nsgene sequence ofV.alginolyticus, the forward primer P1 was ATGTCAGAGCTGACTAAAACCC, and the reverse primer P2 was CTAGATTAGGAACTCATCCAGAGA. The total DNA ofV.alginolyticusHY9901 was used as the template, and the PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s, annealing at 56.3 ℃ for 30 s, extension at 72 ℃ for 30 s, a total of 33 cycles, and extension at 72 ℃ for 5 min. PCR products were detected by 1% agarose gel electrophoresis, and then gel was cut and recovered by DNA gel recovery kit.

2.2.3Sequencing of PCR products. According to the instructions, PCR products were ligated to pMD18-T vector, then transformed intoE.coliDH5α competent cells, screened on LB plate containing Amp+resistance, and positive clones were selected and sent to Guangzhou Sangon for sequencing.

2.2.4Bioinformatics analysis ofh-nsgene ofV.alginolyticus. NCBI (http://blast.ncbi.nlm.nih.gov/blast.cgi) was used for homologous comparison and similarity analysis of sequence; nucleic acid homologous analysis was performed using DNAMAN Version 6.0 (Lynnon Biosoft); ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder/) and ExPASy Proteomics Server (http://ca.expasy.org) were used to deduce amino acid sequences, determine open reading frame (ORF), calculate molecular weight (Mw) and predict theoretical isoelectric point (pI). The signal peptide sequence was predicted by online analysis software SignalP 5.0 Server (https://services.healthtech.dtu.dk/service.php? SignalP-5.0); TMHMM Server 2.0 (https://services.healthtech.dtu.dk/service.php?TMHMM-2. 0) was used to predict the transmembrane domain; SoftBerry-Psite (http://linux1.softberry.com/berry.phtmL?topic=psite &group=programs&subgroup=proloc) was used to predict the distribution of functional sites in amino acid sequences; SMART website (https://smart.embl.de/) was used to analyze protein structure and functional domain; subcellular localization was predicted by PSORT II Prediction (http://psort.hgc.jp/form2.htmL); using Clastal 2.0 and MEGA 5.0, the phylogenetic tree was constructed by neighbor-joining method; SWISS-MODEL (http://www.swissmodel.expasy.org/) program of the ExPASy server was used for modeling; STRING 11.5 interactive database (http://string.embl.de/) was used for analysis of protein-protein interactions.

3 Results and analysis

3.1 Gene amplificationTheh-nsgene was amplified by PCR. The amplified products were analyzed by agarose gel electrophoresis, and a specific band of about 408 bp was amplified (Fig.1). The amplified product and cloning vector pMD18-T were sequenced. The results showed that theh-nsgene contained an open reading frame of 408 bp, encoding 135 amino acids. The amplified product of the gene was submitted to GenBank, and its accession number was OQ181213.

Note: M—DL 2000 DNA molecular weight standard; 1-4—h-ns PCR product.Fig.1 Amplification of h-ns gene

3.2 Physical and chemical propertiesThe physicochemical properties of H-NS protein ofV.alginolyticuswere analyzed by ExPASy software. The results showed that the total number of atoms was 2 123, and the molecular structural formula was C647H1071N185O219S1. The theoretical molecular weight was 14.977 79 kD and the theoretical pI value was 4.99. The instability coefficient was 40.09, and if it was greater than the threshold value of 40, the property was unstable, so the protein was unstable. The fat coefficient was 83.33, the total average hydrophilicity was -0.721, and the whole protein was hydrophobic. The protein did not contain cysteine (Cys), histidine (His), pyrrolidine (Pyl) and selenocysteine (Sec), and the molar extinction coefficient at 280 nm was 8 480 (mol/cm). The total number of acidic amino acid residues (Asp+Glu) was 26, the total number of basic amino acid residues (Arg+Lys) was 21, and the N-terminal was methionine (Met). The half-life in vivo culture in yeast andE.coliwas more than 20 and 10 h, respectively, and the half-life in vitro culture in mammalian reticular cells was 30 h.

3.3 Sequence analysisUsing SignalP 5.0 Server program to predict the N-terminal signal peptide structure of the amino acid sequence ofh-nsgene, it was found that there was no obvious signal peptide cleavage site and no signal peptide in the gene. TMHMM Server 2.0 program was used for prediction, and the results showed that the protein had no transmembrane region. Through SoftBerry-Psite program, it was predicted that the amino acid sequence contained three phosphorylation sites (one protein kinase C phosphorylation site and two casein kinase II phosphorylation sites), one N-terminal myristoylation site and three microsomal C-terminal target signal sites (Fig.2). Protein subcellular localization prediction results showed that H-NS protein was most likely to be located in mitochondria (43.5%), followed by cytoplasm and nucleus (21.74%); the likelihood of being located in the cytoskeleton, peroxisome and secretory system vesicles was 4.3%.

Note: yellow for phosphorylation site of protein kinase C; red for microsomal C-terminal target signal site; purple for N-myristoylation site; green for Casein kinase II phosphorylation site; (*)for terminator.Fig.2 H-NS gene nucleotide and its encoded amino acid sequence

3.4 Homologous and evolutionary analysisDNAMAN software was used for homologous analysis. Comparing the H-NS protein sequence ofVibriocholerae,Vibrioharveyi,Vibrioowensii,Vibriovulnificus,Vibriotubiashii,Vibrionereis,Vibriodiabolicus,Vibriomytili,Vibrioparahaemolyticusand othervibriostrains with the H-NS protein sequence ofV.alginolyticus, it was found that the H-NS ofV.alginolyticusH-NS andVibriodiabolicushad high homology, with a similarity of 97.79% (Fig.3).

Note: Vibrio alginolyticus,OQ181213; Vibrio diabolicus,WP 104971504.1; Vibrio mytili, WP 041156601.1; Vibrio parahaemolyticus, WP 078533361.1; Vibrio harveyi, WP 029789481.1; Vibrio owensii, WP 199437344.1; Vibrio tubiashii, KGY12775.1; Vibrio nereis, WP 053393913.1; Vibrio vulnificus, WP 011150017.1; Vibrio cholerae, WP 193836507.1.Fig.3 Homologous comparison of amino acid sequence of H-NS protein between Vibrio alginolyticus and other vibrios

Using neighbor-joining method of MEGA 5.0, the deduced H-NS amino acid sequences ofV.alginolyticusand other vibrios were used to construct a phylogenetic tree. The results showed thatV.alginolyticusandV.diabolicuswere clustered into the same subfamily, indicating that they were closely related (Fig.4).

Fig.4 Phylogenetic tree of H-NS protein constructed based on neighbor-joining method

3.5 Subunit structureThe amino acid sequence of H-NS gene was submitted to SWISS-MODEL program, and homologous proteins were searched automatically as templates, and the tertiary structure model of single subunit of H-NS protein was obtained. The results showed that H-NS protein mainly consisted of an antiparallel β-fold, a α-helix and a 3(10)-helix, forming a hydrophobic core to stabilize the whole structure. It was close to the model of crystal structure ofS.typhimuriumH-NS 1-83 (SMTL ID: 3nr7.1), with a similarity of 50.63% (Fig.5).

Fig.5 Three-dimensional structural model of H-NS protein subunit of V. alginolyticus

3.6 Prediction of functional domain and secondary structure

Using SMART website program to analyze the functional domain of amino acid structure, the prediction results showed that H-NS protein had two functional domains, HNS and low complexity region (Fig.6).

Fig.6 Functional domain of H-NS protein

HNS domain was bound to DNA (PUBMED: 7875316), and the low complexity region was a low complexity region, starting from 39 aa to 67 aa, with no obvious functional characteristics.

The secondary structure of H-NS protein: α-helix accounted for 66.67%, random coil accounted for 22.22%, extended strand accounted for 5.93%, and β-turn accounted for 5.19% (Fig.7).

Note: Blue, α-helix; Purple, random coil; Red, extended strand; Green, β-turn.Fig.7 Secondary structure of H-NS protein

3.7 H-NS protein crosslinkingProtein cross-linking analysis of H-NS protein using STRING11.5 interactive database showed that the main proteins interacting with H-NS protein were cspA (transcription regulator), VMC_22310 (transcription regulator), hupB (DNA binding protein), seqA (negative regulator), proQ (RNA chaperone), modC, lptC, VMC_37810, cspD and zapB (Fig.8).

Fig.8 Prediction of H-NS protein interaction

4 Discussion

At present, bioinformatics analysis is an important method to predict protein function and structure[16], which can accurately predict protein physicochemical properties and advanced structure[1]. In this study, theh-nsgene ofV.alginolyticuswas successfully cloned and analyzed by bioinformatics. The total length of the gene was 408 bp, 135 amino acids were encoded, the theoretical molecular weight was 14.98 kD, the theoreticalpIvalue was 4.99, the protein was unstable and not hydrophilic. Through on-line prediction, it was found that there were no signal peptide, transmembrane region and KEGG metabolic pathway inh-nsgene; there were three phosphorylation sites, one N-terminal myristoylation site and three microsomal C-terminal target signal sites; H-NS protein had a H-NS domain and a low complexity region, and the secondary structure was mainly composed of α-helix and random coil, and a few extended chains and β-turns; the tertiary structure of H-NS was simulated and the structure of H-NS 1-83 was similar to that of S. typhimurium H-NS 1-83. The homologous analysis showed that H-NS ofV.alginolyticuswas the closest to H-NS ofVibriodiabolicus.

H-NS, as a global negative regulator, binds to bent DNA sequence rich in A-T bases to form DNA-H-NS complex, which inhibits gene transcription and expression. Bending and rich AT bases are a common feature of most gene promoter regions. Most literature has shown that H-NS inhibits the expression of this gene by binding to the related sites in the promoter region of the target gene[17]. This study predicted that the H-NS domain in the secondary structure of H-NS protein ofV.alginolyticuscould bind to DNA, which was consistent with the previous studies. However, there is no relevant research onh-nsgene ofV.alginolyticusat present. Through amplification and bioinformatics analysis ofh-nsgene, it lays a foundation for exploring the regulation mechanism of its protein on bacterial virulence in the future.