Cloning and Functional Analysis of Calcineurin Subunits A and B in Development and Fecundity of Nilaparvata lugens (Stål)

Wang Weixia, Zhu Tingheng, Wan Pinjun, Wei Qi, He Jiachun, Lai Fengxiang, Fu Qiang

Research Paper

Cloning and Functional Analysis of Calcineurin Subunits A and B in Development and Fecundity of(Stål)

Wang Weixia1, Zhu Tingheng2, Wan Pinjun1, Wei Qi1, He Jiachun1, Lai Fengxiang1, Fu Qiang1

(State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006, China; College of Biotechnology )

Serine/threonine phosphatase calcineurin (CN) is a unique but confounding calcium/calmodulin- mediated enzyme, which is composed of a catalytic subunit A (CNA) and a regulatory subunit B (CNB). We cloned six transcripts fornamed fromto, onenamedand one CNB homologous genefromAll of them are constitutively transcripted invarioustissues and developmentalstages. The primary structure of the six isoforms showed obvious differences in the length and composition of the amino acid sequence between the two binding domains of Ca2+/calmodulin (CaM) and CNB. Ca2+-binding EF-hand motifs were found in NlCNB1 and NlCNBH1. The specific gene silencing of,andrespectively by RNAi resulted in drastical reduction in survival rate, female weight, eclosion rate and fecundity of. These results showed that,andwere required forgrowth and reproduction. The negative effects ofsilenceonnymph mortality (97%), molting malformation (90%) and female sterile (50%) were more serious than those oforqRT-PCR and enzyme-linked immunosorbent assay (ELISA) analyses indicated that the nymphs with silenced,orshowed impaired hormone and energy metabolism. In nymphs, the contents of 20-hydroxyecdysone (20E) afterRNAiand phenoloxidase afterRNAiwere particularly decreasedThese results suggested thatis involved in immunity ofby regulation of phenoloxidase, whilemay control the growth and development ofby 20E signaling pathway in addition to interact with CNA. Injection of 70 ng/μL dsNlCNB1 resulted in 77.0% down regulation of, and the nymph mortality was up to 57.9% at 10 d after injection. Therefore, NlCNB1 could be a potential candidate target used for strategy design in control of. Our results revealed the importance of CN in the regulation of the growth and development of, which provided a basis for further study of the molecular mechanism of CN.

; calcineurin; calcineurin catalytic subunit; calcineurin regulatory subunit; 20-hydroxyecdysone; phenoloxidase

Rice () is the staple food for over half of the world’s population and is produced on more than 162.06 million hectares worldwide in 2019 (https:// www.statista.com). Rice production is severely affected by insect pests, and the most damaging pest of rice in Asia is rice brown planthopper,Stål (Bottrell and Schoenly, 2012). In China,has frequently experienced outbreaks following the adoption of hybrid rice in the 1980s (Chen et al, 2011). Pesticides are commonly used for control of, however, widespread use of chemical pesticides often results in insecticide resistance and the elimination of natural enemies (Preetha et al, 2010). In order to effectively resist the planthopper population and selectively protect natural enemies, developing new insecticides by excavating and analyzing the key genes ofare urgently needed.

Protein kinases and phosphatases are partners, and their activities are coordinated in regulating signaling responses (Tonks, 2006, 2013). Calcineurin (CN) is a widely distributed Ser/Thr, calcium and calmodulin- dependent protein phosphatase. CN modulates cell function by direct dephosphorylation of various functional proteins or by crosstalk with other signal transduction pathways (Sugiura et al, 2001). CN is composed of a catalytic subunit, calcineurin A (CNA) (58 kDa), and a NH2-terminal myristoylated regulatory subunit, calcineurin B (CNB) (19 kDa) (Rusnak and Mertz, 2000). The large CNA subunit has a phosphatase activity and consists of several domains: a catalytic domain which regulates protein dephosphorylation, a CNB-binding domain, a CaM-binding domain and an autoinhibitory domain (Aramburu et al, 2000; Shibasaki et al, 2002). CNB has four EF-hand Ca2+binding sites with homology to calmodulin, and its primary sequence is well conserved in higher eukaryotes.

CN has been extensively studied in diverse groups of organisms especially in mammals. It was demonstrated that CN signaling inregulates lipolysis, development, behavior and aging (Lee et al, 2013; Wang et al, 2017). Research of CN in insects is mainly focused on. CN inhibits the process of synaptic vesicle endocytosis at nerve terminals inlarvae (Kuromiet al, 1997). It is required for completion of meiosis (Takeo et al, 2010; Nakai et al, 2011) and flight muscle formation (Gajewskiet al, 2003), and is even involved in sleep and memory regulation (Tomita et al, 2011). Misexpression of the constitutively active form of a CNA protein leads to increased sleep and CNA knockdown also impaires the retention of aversive olfactory memory in. CN appears to promote the induction of innate immune responses and plays a pivotal role in controlling systemic energy and body weight homeostasis (Dijkers and O’Farrell, 2007; Pfluger et al, 2015). In salivary glands of, CN mediates cAMP/PKA signaling pathways and activates V-ATPase (Vosset al, 2010). In, CN is cloned from pheromone glands, and participates in the signal transduction of pheromone biosynthesis activating neuropeptide (Fónagyet al, 1999; Yoshiga et al, 2002). However, few attempts have been made to characterize and uncover the functions of other insect CNs.

In this study, two subunits of CN (NlCNA and NlCNB1) and one calcineurin B homologous protein 1 (NlCNBH1) were isolated fromand their roles were investigated using RNAi. Our results demonstrated that,andwere required fordevelopment and reproduction.wasfound to participate in the 20-hydroxyecdysone (20E) signal pathway other than the activation of CN in.

RESULTS

Sequence analysis

Based on the assembled transcriptome ofconstructed in our laboratory, sequences for the catalytic subunit A and the regulatory subunit B of CN were selected. One CNB homologous protein was found whengenome was blasted with CNA and CNB amino acid sequences. Three specific PCR primer pairs were used to clone these three genes from(Table S1). Totally, eight cDNA sequences with entire open reading frames (ORF) were amplified and assembled. These cDNA sequences were deposited in GenBank under accession numbers from MT780262 to MT780269. Six sequences (namedto) shared high identity with predicted serine/ threonine-protein phosphatase 2B catalytic subunit of(up to 78.6% identity with an-value of 0.0 and 88.0% coverage). One sequence namedwith the length of 720 bp shared high identity with predicted CNB type 2 of(up to 80.6% identity and 71.0% coverage) and one sequence namedwith the length of 994 bp shared high identity with predicted CNB homologous protein 1 of(up to 77.5% identity and 57.0% coverage). The cDNA sequences were blasted against NCBI andgenomic data. Eight cDNA sequences have one blast hit with ≥ 90% query cover and-value of 0.0.

The cDNAs oftocontain entire ORF encoding proteins of 536, 531, 520, 512, 511 and 510 amino acids respectively with the predicted molecular weights (MW) of 57.0‒59.8 kDa and isoelectric points (pI) of 6.07‒6.65. The differences among the six different transcript variants ofare mainly between the 12th and the 14th exons. The cDNA ofcontains an entire ORF of 513 bp, encoding a protein of 171 amino acids with the predicted MW of 19.4 kDa and pI of 4.31. The cDNA ofcontains an entire ORF of 573 bp, encoding a protein of 191 amino acids with the predicted MW of 21.9 kDa and pI of 4.66. Analysis of the genomic position and structure showed that,andwere located at scaffold 262, 5431 and 8 respectively in. Sequences cloned in the present study were submitted to GenBank and their accession numbers, blast information, lengths of ORF, the number of exons, gene loci, pI and MW of deduced amino acids are illustrated in Table 1.

Table 1. Genes cloned from N. lugens and their sequence characteristics.

ORF, Open reading frame; MW, Molecular weight; pI,Isoelectric point. ‘/’, The number of exons inwas uncertain.

All CNA genes encode a polypeptide consisting of a catalytic domain homologous to other serine/ threonine protein phosphatases and three regulatory domains (CNB-binding domain, CaM-binding domain and autoinhibitory domain) at the COOH terminus (Rusnak and Mertz, 2000). These domains were also found in NlCNA (Fig. S1). The sequence differences among the NlCNA isoforms mainly at the region between the CNB- and CaM-binding domains. Four and two Ca2+-binding EF-hand motifs were found in NlCNB1 and NlCNBH1, respectively (Figs. S2 and S3). The eight N-tail residues (GNESSLPM) of NlCNB1 is a conserved sequence for myristoylation. NlCNBH1 showed a substantial sequence similarity (38.6% identity) to NlCNB1.

Protein sequences of 11 CNBs and CNBHs, and 5 CNAs from various insects were aligned by the clustal analysis. The longest sequences for CNA from each insect were chose and used for construction of phylo- genetic tree. The correlation of the insect CNA, CNB and CNBH protein sequences are depicted in Fig. S4.

Developmental and tissue-specific expression of NlCNA, NlCNB1 and NlCNBH1 in N. lugens

Using gene-specific primers, we performed the qRT-PCR analysis on RNA isolated from various tissues and different developmental stages of. The results showed that the three genes were widely expressed in different tissues and stages (Fig. 1). The expression level ofwas about 5-fold higher than those ofandin all tissues assessed. The three genes showed very similar expression patterns, with the lowest expression level in the thorax (Fig. 1-A to -C).expressed higher in salivary glands and ovaries than in fat bodies (Fig. 1-A),expressed higher in salivary glands and guts than in ovaries and fat bodies (Fig. 1-B), andexpressed significantly higher in fat bodies and ovaries than in guts (Fig. 1-C). The qRT-PCR experiments revealed that,andwere expressed at all developmental stages of, changed synchronously and expressed the most highly in early embryos (Fig. 1-D to -F).

Fig. 1. Expression analyses of,andat various tissues (A‒C) and developmental stages (D‒F) in.

SG, Salivary gland; FB, Fat body; E-1, 0‒48 h embryo; E-2, 72‒96 h embryo; E-3, 120‒144 h embryo; 1N-1d‒5N-3d, From the first day of the 1st instar nymph to the third day of the 5th instar nymph; NF, Newly emerged female; NM, Newly emerged male; F-2d, Adult females at 2 d after eclosion; M-2d, Adult males at 2 d after eclosion. Three biological replications (Mean ± SE) were carried out for each gene based on independent samples, and relative expression levels of target genes were calculated by the equation= 10(Ct internal ‒ Ct target) / 3× 100%. Different lowercase letters above the bars indicate significant differences among different tissues by the Duncan’s multiple range test at< 0.05.

Effects of RNAi on nymphal performance of N. lugens

Two independent, non-overlapping dsRNAs (dsNlCNA1 and dsNlCNA2), which target six transcript variants, were designed to down-regulateexpression. Other two dsRNAs (dsNlCNB1 and dsNlCNBH1) were designed to down-regulateandexpression, respectively. The 3th instar nymphs were used to analyze the effect of RNAi on survival rate. Injecting of 70 ng/nymph of dsNlCNA, dsNlCNB1 or dsNlCNBH1 caused a significant decrease in the survivorship of. The survival rates of nymphs began to decrease at 2 d after injecting of dsNlCNA1 or dsNlCNA2 (Fig. 2-A). The survival rates at 4 d after injection was significantly decreased in nymphs injected with dsNlCNA1, dsNlCNA2, dsNlCNB1 and dsNlCNBH1 compared with the control dsGFP (Fig. 2-A to -C). At 6 d after injection, the survival rates of nymphs gradually decreased to 37.9% (dsNlCNA1), 35.6% (dsNlCNA2), 51.1% (dsNlCNBH1) and dramatically decreased to 28.3% (dsNlCNB1). At 10 d after injection, the survival rates of nymphs decreased to 10.4% (dsNlCNA1), 15.9% (dsNlCNA2), 20.3% (dsNlCNBH1) and 2.8% (dsNlCNB1) compared to dsGFP (91.0%). Almost no nymphs injected with dsNlCNB1 developed into the adult stage. Nymphs injected with dsNlCNA or dsNlCNBH1 showed gradually death, whereas those injected with dsNlCNB1 showed dramatical death in molting. Approximately 90% of nymphs with silenceddied during molting or emergence (Fig. 3).

Compared to the dsGFP control, the expression of RNAi suppressed target gene can be significantly sustained for 10 d after dsRNA injection. The transcript levels ofdecreased by 74.6% and 75.3% at 4 d after injection and 59.3% and 62.2% at 10 d after injection of dsNlCNA1 and dsNlCNA2, respectively (Fig. 2-D). The transcript levels ofdecreased by 90.5% and 55.0% at 4d and 10 d respectively after injection of dsNlCNB1 (Fig. 2-E). Similarly, the transcript levels ofdecreased by 94.8% and 95.4% at 4 d and 10 d respectively after injection of dsNlCNBH1 (Fig. 2-F).

Fig. 2. Effects of dsRNA on survivorship of(A‒C) and mRNA levels of target genes (D‒F).

The 3rd instar nymphs were injected with specific dsRNA and observed for phenotypic variations at 24 h intervals. Individuals treated with dsGFP were used as a control. The survival rate was calculated from four biological replicates (Mean ± SE). For each treatment, 30 nymphs were used. mRNA levels of target genes from five nymphs at 4 and 10 d after injection in.were analyzed by qRT-PCR with the 2‒ΔΔCTmethod from three biological replicates (Mean ±SE). Significant differences between the treatment and control are indicated with asterisks (*,< 0.05).

Fig. 3. Effects of dsRNA injection on nymphal molting.

A, Normal phenotype nymphs injected with dsGFP.

B‒F, Abnormal phenotype nymphs injected with dsNlCNB1. About 90% nymphs with silencedfailed to shed the exuviae completely and did not molt into next stage.

Negative effects of dsRNA on eclosion rate and fecundityof N. lugens

The 4th instar nymphs were treated with dsRNA to assess the effects of RNAi on eclosion rate and reproduction. In the treatments with dsNlCNB1 and dsNlCNBH1 injection, the eclosion rates weresignificantly reduced to 47.5% and 66.4%, respectively, when compared to the dsGFP control (96.2%) (Fig. 4-A), whereas no significant difference was observed in the treatment of dsNlCNA. The body weights of newly emerged females were significantly decreased in the treatments of dsNlCNB1 and dsNlCNA (Fig. 4-B).

The mean numbers of eggs produced by parent pairs treated with dsNlCNA and dsNlCNBH1 were 326.9 and 258.0 per female, respectively, significantly lower than that of the control dsGFP (504.5 per female). There was no significant difference in hatchability between dsNlCNA, dsNlCNBH1 and dsGFP (Table 2). Only 7 of 14 females injected with dsNlCNB1 laid eggs with the mean number of 75.0. Among these 7 females, 2 females laid more than 300 eggs and the hatching rate was up to 100%. The RNAi test on these two females may have failed. The remaining seven females injected with dsNlCNB1 did not lay eggs. More serious effect on the fecundity ofwas found in females injected with dsNlCNB1 than that injected with dsNlCNA and dsNlCNBH1.

Fig. 4. Effects of dsRNAs on eclosion rate (A) ofand body weight of newly emerged females (B).

The 4th instar nymphs were injected with specific dsRNA. Individuals treated with dsGFP were used as a control. The eclosion rate was calculated from three biological replicates (Mean ± SE). For each treatment, 30 nymphs were used. The newly emerged females were weighted with an electronic balance from three biological replicates (Mean ± SE). For each treatment, five nymphs were used. Different lowercase letters above the bars indicate significant differences among different treatments by the Duncan’s multiple range tests at< 0.05.

The development of ovary was affected significantly in female. Ovaries of these females were dissected at 2 and 4 d after eclosion. In the control group injected with dsGFP, the ovaries developed well and were easy to peel. At 2 d after eclosion, the ovaries were at the transparent stage (grade I) or vitellogenesis stage (grade II) (Fig. 5-A and -B). At 4 d after eclosion, the ovaries were at grade III and milky white banana-shaped mature eggs appeared at the base of the ovarian tubules (Fig. 5-C and -D). Morphological photographs of ovaries showed that there was no obvious difference between dsNlCNA, dsNlCNBH1 and the control group at 2 d after eclosion (Fig. 5-E, -F, -M and -N). At 4 d after eclosion, the ovaries were at grade II and little or no milky white banana-shaped mature eggs appeared at the base of the ovarian tubules in the treatment group with knockdown ofor(Fig. 5-G, -H, -O and -P). Knockdown ofmade it difficult to peel off the ovaries at 2 d after eclosion (Fig. 5-I and -J), resulting in slower ovarian development or even deformity, and reduced the number of eggs (Fig. 5-K and -L). At 4 d after eclosion, normal ovaries developed into the matured stage (grade III), while most of the ovaries in the-silencing group developed into the vitellogenesis stage (grade II).

Table 2. Effects of NlCNA, NlCNB1 and NlCNBH1 on fecundity of N. lugens.

Different lowercase letters indicate significant differences among different treatments by the Duncan’s multiple range test at< 0.05.

Fig. 5. Developmental status ofovaries.

A‒D, Normal ovaries were dissected and photo- graphed under a dissection microscope from females injected with dsGFP at 2 and 4 d after eclosion.

E‒H, Ovaries from females injected with dsNlCNA at 2 and 4 d after eclosion.

I‒L, Abnormal ovaries from females injected with dsNlCNB1 at 2 and 4 d after eclosion.

M‒P, Ovaries from females injected with dsNlCNBH1 at 2 and 4 d after eclosion.

Molecular mechanism for modulating development and fecundity in N. lugens by NlCNA, NlCNB1 and NlCNBH1

The pathways including ecdysone and juvenile hormone (JH), insulin, nutrition- related target of rapamycin (TOR) and energy metabolism play a critical role in regulation of growth and development in. To uncover the possible molecular mechanism for modulating development and fecundity inby,and, the expression of 10 genes associated with those pathways were analyzed using qRT-PCR after RNAi (Fig. 6). The primers used for qRT-PCR analysis were designed according to Li et al (2017) and Chen et al (2019).The expression levels oftwo Halloween genesandinvolve in the 20E biosynthesis, andand broad complax () involve in the 20E signal pathway were significantly decreased, whereas the expression levels of ecdysone receptor () was significantly increased in the nymphs injected with dsNlCNB1 when compared to those treated with dsGFP (Fig. 6-A to -D and -F). The expression levels ofjuvenile hormone receptor (methoprene tolerant) decreasedsignificantly in the nymphs injected with dsNlCNBH1 and dsNlCNA (Fig. 6-E). The expression level ofwas also significantly decreased in the nymphs injected with dsNlCNA (Fig. 6-F). The expression levels of S6 kinase () and forkhead box protein O (), the key components of TOR and insulin signaling pathways respectively, were also significantly decreased in the nymphs injected with dsNlCNB1, dsNlCNBH1 or dsNlCNA (Fig. 6-G and -H).

Fig. 6. Expression analysis of 8 among 10 selected genes in response to RNAi.

The 4th instar nymphs were injected with specific dsRNA. Nymphs treated with dsGFP were used as a control. Five newly emerged females were collected for RNA extraction and mRNA levels of target genes were analyzed by qRT-PCR with the 2‒ΔΔCTmethod from three biological replicates (Mean ± SE). Different lowercase letters above the bars indicate significant differences among different treatments by the Duncan’s multiple range tests at< 0.05.

Fig. 7. Relative physiological and biochemical changes affected by dsRNAs.

Calcineurin content (A), calcineurinenzyme activity (B), phenoloxidasecontent (C), pyruvic acid content (D),20-hydroxyacdysone (20E) content (E) and trehalose content (F) were analyzed between different treatments of newly emerged females and males. Three replicates were conducted (Mean ± SE). Different lowercase letters above the bars indicatesignificant differences among different treatments by the Duncan’s multiple range test at< 0.05.

At the physiological and biochemical levels, a rapid enzyme-linked immune-sorbent assay (ELISA) was used to measure the enzyme activities and the contents of CN, immunity-related phenoloxidase, energy- related pyruvic acid (PA), 20E and trehalose. The CN content and activity were significantly decreased ininjected with dsNlCNA (Fig. 7-A and -B). The phenoloxidase content was significantly decreased and the PA content was significantly increased ininjected with dsNlCNA (Fig. 7-C and -D). The content of 20E was significantly decreased ininjected with dsNlCNB1 (Fig. 7-E), and also decreased in the groups with silencedor, but did not reach a significant level compared with the control dsGFP. The content of trehalose was not affected significantly in the three treatment groups (Fig. 7-F).

According to the above results, NlCNB1 can be used as an effective candidate target for design strategies in control of. To determine the sensitivity ofto dsNlCNB1, a series of concentration gradient (10-fold dilution from 700 to 0.07 ng/μL) experiments were performed. For the nymphs injected with 700 and 70 ng/μL dsNlCNB1, the survival rate decreased from 3 d after injection, and dropped sharply to 2.8% and 42.1% respectively at 10 d after injection. With the dose of dsNlCNB1 decreased to 7 ng/μL, the survival rate increased to 69.8% (Fig. 8-A). Compared with the expression level in nymphs injected with dsGFP, the levels ofsignificantly decreased by 90.4%, 77.0% and 46.6% when injected with 700, 70 and 7 ng/μL dsNlCNB1, respectively (Fig. 8-B). When the concentration of dsNlCNB1 was below 0.7 ng/μL, the expression of target gene and survival rate of the nymphs did not significantly reduce compared with the control. This result showed that when the expression ofgene was reduced to more than 77.0%, the mortality rate of nymphs increased significantly and reached 57.9%.

Fig. 8. Survival rate (A) andmRNA abundance (B) ofthat treated with different concentrations of dsNlCNB1.

dsNlCNB1-700 to dsNlCNB1-0.07 refer to the concentrations of dsNlCNB1 used for injection from 700 to 0.07 ng/μL. The survival rate was calculated from three biological replicates with 30 nymphs each (Mean ± SE). mRNA level ofat 4 d after injection were analyzed by qRT-PCR with the 2-ΔΔCTmethod from three biological replicates (Mean ± SE). *,< 0.05; **,< 0.01.

DISCUSSION

CN in N. lugens

CN is a highly conserved Ca2+/calmodulin-dependent protein phosphatase and is known to be involved in a myriad of cellular processes and signal transduction pathways (Klee et al, 1998; Rusnak and Mertz, 2000). CN is a heterodimer composed of CNA and CNB subunits. Each subunit is encoded by one or more genes and is considered as an evolutionarily conserved protein in all eukaryotes. The NH2and COOH termini are highly variable between species as well as between CNA genes within the same organism (Rusnak and Mertz, 2000).has five CNA genes encoding three isoforms of CNA subunits (CanA-14F, Pp2B-14D and CanA1) and two isoforms of CNB subunits (CNB1 and CNB2) (Takeo et al, 2010).

Based on the transcriptome database of, six different transcript variants for CNA subunit, one for CNB subunit and one for CNB homolog were cloned. The deduced NlCNA protein contained a regulatory domain with a highly hydrophobic CNB- binding site, followed by the CaM-binding domain and the autoinhibitory domain. The difference between the different isoforms of NlCNA was between CNB- binding domain and CaM-binding domain. NlCNB shows four EF-hand Ca2+loops and conserved glycine residues. Similarly, NlCNBH1, which is another EF- hand protein, conserves the NlCNA interacting sites. This is consistent with the results observed in other eukaryotic organisms.

CN is necessary for N. lugens development

qRT-PCR showed thatandwere constitutively expressed at different developmental stages and various tissues of, especially highly expressed in the early embryo as reported in(Brown et al, 1994). High efficiency of RNAi was demonstrated by their significant effect on suppressing the expression of target genes after injection. Knockdown oforresulted in the decline of nymph survival rate and fecundity of. Ovarian anatomy showed that the silencing oforgenes slowed down the development of the ovary and reduced the number of oocytes. The silencing ofcan also cause abnormal development of ovary.

CN has been identified as the dephosphatase of protein phosphatase 2B family and participates in various biological pathways, including immunity pathways (Crabtree, 2001; Bueno et al, 2002; Furman and Norris,2014). To reveal mechanisms underlying the regulation of NlCNA, NlCNB1 and NlCNBH1- mediated viability and female fecundity in, we performed qRT-PCR analysis for gene expression associated with hormone, TOR and insulin pathways. One TOR pathway-associated gene, and a downstream factor of insulin pathwayhad significantly lower expression levels after,orRNAi. While the expression of two key upstream genes of the TOR pathway,and, were not affected compared to the control (dsGFP) (data not shown). In the lepidopteran insect, knockdown ofin the 5th instar larvae results in larval molting failure (Caiet al, 2016). In,the effect of 20E is attenuated aftergene knockdown (Zhang et al, 2020). Recently, Dong et al (2021) found that FoxO modulatesfecundity through binding to the promoters of,and the exon of,and affecting their gene expression in the Vg network. In this study, the knockdown of,orled to decreased survivability and fecundity, and lowered expression ofandThese indicated that a positive relationship exists among CN and FoxO. However, it is not clear whether CN influences the expression ofdirectly or indirectly.

The CN activity, the contents of CN, phenoloxidase, PA, trehalose and 20E were measured using ELISA. As expected, the activity and content of CN decreased significantly inwith silencedIn, CN isoforms, Pp2B-14D/ CanA-14F, involves in toll-mediated immune signaling (Li and Dijkers, 2015). Insect prophenoloxidase is an important innate immunity protein, protecting hosts from infection and may also affect insect longevity and development (Lu et al, 2014). In, when the activity of CN decreases, the activities of other immune-related enzymes also decrease (Li, 2016). In., CN, as an activator of the immune gene, might enhance the insecticidal activity of Cry1Ac againstby regulating immune gene expression via dephosphatase activity (Wei et al, 2021). Our result also showed that the content of phenoloxidase decreased in dsNlCNA-treated nymphs with the decrease of CN activity.

Moreover, our results found that the nymphs with silencedshowed a significant increase in PA content. PA is the connection point between glycolysis and TCA cycle, which can be used for the biosynthesis of lysine, fatty acids and other branched-chain amino acids (Hu et al, 2016). Pyruvate kinase mediates the conversion of phosphoenolpyruvic acid and ADP into PA and ATP (Rider et al, 2011). In, pyruvate kinase levels are significantly increased after injection of dsLsFoxO (Yin et al, 2018). Our data proved that CN can regulate the expression ofandgenes, thereby regulating the synthesis of immune-related enzymes and other functional proteins in.

Regulatory subunit B of CN plays a more important role by regulating ecdysone signaling pathway

Subunit CNB is important for the structural integrity of the CN enzyme. However, the nymphs with silencedshowed no decrease in enzyme activity. Therefore, the possible explanation for this result is that the concentration of N1CNB1 and N1CNA is not at a ratio of 1:1, and the RNAi technology only partially silencedexpression without affecting the enzyme activity of CN. However, the typical phenotype of nymphs with silencedwas abnormal molting and even female sterile, suggesting thatmay play potential roles in control of reproduction through regulating other targets.

Insect molting, metamorphosis and reproduction are governed by ecdysteroids and JH (Yamanaka et al, 2013; Kayukawa et al, 2017). Ecdysone and 20E orchestrate the molting process, and JH determines the nature of the molt (Riddiford et al, 2003). Our result showed that most of nymphs injected with dsNlCNB1 died during molting or eclosion, so we further conducted qRT-PCR experiment to examine the expression levels of nuclear receptor genes involving in the 20E and JH signaling pathways and two Halloween genes involving in 20E biosynthesis. The results showed that the two Halloween genesandwere significantly down-regulated andwas up-regulated in nymphs with silencedTo determine if the altered expression of pathway genes could affect hormone biosynthesis, the assessment of 20E with ELISA was conducted. The result showed that knockdown ofled to a significant decrease in the 20E content of, which eventually prevented molting and resulted in the death of. These results suggested thatNlCNB1 may bind multiple effectors especially associated with 20E pathway and potentially modulate their functions or by crosstalk with other signal transduction pathways in addition to the combination with NlCNA.

We also determined the sensitivity ofto dsNlCNB1, the expression ofgene reduced to more than 77.0% with 70 ng/μL dsNlCNB1 injection, and the mortality rate of nymphs increased significantly and reached 57.9%. Therefore, NlCNB could be an effective candidate target used for design strategies in control of.

CNB homologous protein, another important EF-hand protein in N. lugens

CNBH1 is a calcium-binding protein that plays a role in membrane trafficking, cell proliferation and gene transcription, and binds to multiple effector proteins, including Na+/H+exchangers, serine/threonine protein kinases and CN, potentially modulating their functions (Lin et al, 1999; Pang et al, 2001; Kuwahara et al, 2003; Naoe et al, 2005; Jiménez-Vidal et al, 2010; Li et al, 2011; Wagner et al, 2011; Allman et al, 2016). Knocking downresulted in the decline of nymph survival rate and fecundity, the slowing down of the ovary development and the reduction of the number of oocytes in. Although the silencing of theled to the down-regulation of genes such as,,and, the specific underlying regulatory mechanisms are still unclear in.

There is an intricate crosstalk between nutrient sensing, JH and ecdysone signaling pathways underlying insect reproduction. This study proved the importance of CN in the regulation of growth and fecundity ofvia immunity, energy metabolism and hormone pathways at different levels. It also proved that NlCNB1 is a key regulator of both CN and 20E signaling pathways and thus can be a potential candidate target used for design strategies in control of planthopper.

METHODS

Samples

were reared on rice variety Taichung Native 1 at 26 ºC ± 2 ºC under a 16 h light/8 h dark cycle. Eggs (200) within 48, 72‒96 and 120‒144 h, and the individuals from the first day of the 1st instar (100), 2nd (100), 3rd (50), 4th (20) to the third day of the 5th instar nymphs (10) as well as newly emerged females (10) and male adults (10) were randomly selected. Adult females at 2 d after eclosion were immobilized by placing them in a freezer for 15 min, and their midguts (50), salivary glands (100), fat bodies (50), ovaries (50), heads (20), abdomens (20) and thoraces (20) were dissected with tweezers. The number of insects in each sample was given in parentheses above. All samples were collected in triplicate. The samples were frozen in liquid nitrogen and stored at -80 ºC prior to RNA extraction.

Cloning and sequence analysis

Total RNA was extracted from pooled samples (from the 1st to the 5th instar nymphs and adults) using RNasey®Mini Kit (Qiagen, Shanghai, China) following the manufacturer’s instructions, and treated with DNase I (Fermentas, Ontario, Canada). Then, cDNA was synthesized using a First Strand cDNA Synthesis Kit (Toyobo, Shanghai, China). PCR primers were designed based on transcriptome database from, and listed in Table S1. PCR conditions were as follows: 94 ºC for 3 min, 40 cycles of 94 ºC for 30 s, 58 ºC for 30 s, 72 ºC for 1 min, followed by final extension at 72 ºC for 7 min. The purified fragment was inserted into the TOP2.1 vector and transformed intoDH5α, then sequenced (Boshang, Inc., Shanghai, China).

ORF was predicted using ORF Finder (http://www.ncbi.nlm. nih.gov/gorf/gorf.html). The similarity analysis of deduced amino acid sequences was performed using the BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The phylogenetic analyses were conducted with MEGA 5.0 (http://www.megasoftware. net/) by the maximum parsimony method using amino acid sequences of other insects and human CNA (NP_001124163) as an outgroup. The ExPASy Compute pI/MW tool (http://web. expasy.org/compute_pi/) was used to predict MW and pI.

RNA extraction and qRT-PCR analysis

Total RNA was isolated fromat different developmental stages and various tissues. cDNA synthesis was performed as described above. Thegene (JN410820) and(JN662398) were used as references for qRT-PCR analysis (Wanget al, 2015). Using 10-fold diluted cDNA as a template, qRT-PCR reactions were carried out in triplicate on a thermal cycler (CFX-96, Bio-Rad, Philadelphia, PA, USA) with 2× SYBR Mixture (Roche, Basel, Switzerland) according to the manufacturer’s instructions. Thermal cycling conditions were 95 ºC for 10 min, 40 cycles of 95 ºC for 15 s, and 60 ºC for 1 min, then followed by dissociation analysis to check the homogeneity of the PCR product. Relative value for the expression level of target gene was calculated by the equation= 10(Ct internal ‒ Ct target) / 3× 100% (internal,mean value of genome for two reference genes) (Hou et al, 2012).

dsRNA synthesis and RNAi

The double-stranded RNA (dsRNA) synthesis, microinjection experiment and bioassay were conducted based on Wang et al (2015). dsRNA primer was conjugated with the T7 RNA polymerase promoter (TAATACGACTCACTATAGGG). About 0.1 μL (70 ng) dsRNA was injected into the individuals of. Nymphs injected with dsRNA were collected from each treatment. Total RNA was isolated from the RNAi-treated and untreated control nymphs of five by using RNeasy®Mini Kit (Qiagen, Shanghai, China) according to the manufacturer’s instructions. The efficiency and specificity of RNAi were examined by qRT-PCR. The relative amounts of gene transcripts were expressed as a ratio between treated group and control group by the 2‒ΔΔCTmethod (Livak and Schmittgen, 2001).

Assessment of biochemical substances with ELISA

The activity of CN or the contents of CN, phenoloxidase, trehalose, PA and 20E were measured by commercial specifical insect kits including CN ELISA (MSKBIO, Wuhan, China), PLO ELISA (X-Y Biotechnology, Shanghai, China), trehalose ELISA (Boshen, Jiangsu, China), PA (Solarbio, Beijing, China) and 20E ELISA (Spibio, France), respectively. Whole bodies of five newly emerged females and males were weighed and homogenized in 500 μL phosphate-buffered saline (PBS) buffer containing 0.05% Tween-20 with a glass tissue grinder in an ice bath. Homogenates were centrifuged at 10 000 ×for 10 min at 4 ºC, and the supernatants were used for measurement of CN, phenoloxidase, trehalose and PA following the manufacturer’s instructions. The optical density was read at 450 nm on a Sunrise ELISA reader (Tecan, Maennedorf, Switzerland). For 20E extraction from, whole bodies of five newly emerged females were homogenized in 300 μL methanol with a glass tissue grinder in an ice bath. Homogenates were centrifuged at 10 000 ×for 5 min at 4 ºC, and the supernatants were collected and evaporated until completely dry. Sample was dissolved in 100 μL EIA buffer provided in 20E ELISA Kit and used for measurement of 20E. The optical density was read at 414 nm on a Sunrise ELISA reader (Tecan, Maennedorf, Switzerland).

Bioassay and data analysis

The survival rates of the 3rd instar ofafter injection were observed at a 24-h interval with duration of 10 d. To study the fecundity and egg-hatching rate, the injected 4th-instar nymphs in each treatment were separated into two groups. The first group was used to record the number of eggs and offspring. Once the 5th instar after injection emerged, each female was matched with one male and each pair was put into one cage. In total, 12‒14 pairs per gene were successfully matched. The number of newly hatched nymphs was recorded every other day until the parents died. The number of unhatched eggs was also recoded. The second group was used to study the gene expression, ELISA analysis and ovary dissection. Five newly emerged females were collected for gene expression. Five newly emerged females and males were collected for ELISA analysis. Six females were collected from each treatment at 2 and 4 d after adult emergence and ovaries were dissected, then photographed with a VHX-2000 microscope. We used the grading criteria developed by Lu et al (2011) to determine the ovarian development.

The differences between control and RNAi treatments were analyzed using one-way analysis of variance followed by the Duncan’s multiple range test for multiple comparisons. Statistical differences were considered significant at< 0.05.

ACKNOWLEDGEMENTS

This study was supported by the China Agriculture Research System (Grant No. CARS-01-38), Rice Pest Management Research Group of the Agricultural Science and Technology Innovation Program of China Academy of Agricultural Science (Grant No. CAAS-ASTIP-2016-CNRRI), Central Public-Interest Scientific Institution Basal Research Fund of China (Grant No. CPSIBRF-CNRRI-202122), and Open Project Program of State Key Laboratory of Rice Biology, China (Grant No. 20210302).

SUPPLEMENTAL DATA

The following materials are available in the online version of this article at http://www.sciencedirect.com/journal/rice-science; http://www.ricescience.org.

Fig. S1. Primary sequence and domain structure of CNA and amino acid sequence alignment ofNlCNA proteins.

Fig. S2. Amino acid sequence alignment of CNB proteins from 11 insects.

Fig. S3. Amino acid sequence alignment of CNBH proteins from 11 insects.

Fig. S4. Unrooted phylogenetic tree of NlCNA-X1, NlCNB1 and NlCNBH1 fromand representative insect species.

Table S1. Primers used in this study.

Allman E, Wang Q, Walker R L, Austen M, Peters M A, Nehrke K. 2016. Calcineurin homologous proteins regulate the membrane localization and activity of sodium/proton exchangers in., 310: C233‒C242.

Aramburu J, Rao A, Klee C B. 2000. Calcineurin: From structure to function., 36: 237‒295.

Bottrell D G, Schoenly K G. 2012. Resurrecting the ghost of green revolutions past: The brown planthopper as a recurring threat to high-yielding rice production in tropical Asia.,15: 122–140.

Brown L, Chen M X, Cohen P T. 1994. Identification of a cDNA encoding acalcium/calmodulin regulated protein phosphatase, which has its most abundant expression in the early embryo., 339: 124‒128.

Bueno O F, Brandt E B, Rothenberg M E, Molkentin J D. 2002. Defective T cell development and function in calcineurin A beta- deficient mice., 99: 9398–9403.

Cai M J, Zhao W L, Jing Y P, Song Q, Zhang X Q, Wang J X, Zhao X F. 2016. 20-Hydroxyecdysone activates Forkhead box O to promote proteolysis duringmolting., 143(6): 1005‒1015.

Chen M, Shelton A, Ye G Y. 2011. Insect-resistant genetically modified rice in China: From research to commercialization., 56: 81–101.

Chen W W, Kang K, Yang P, Zhang W Q. 2019. Identification of a sugar gustatory receptor and its effect on fecundity of the brown planthopper., 26(3): 441‒452.

Crabtree G R. 2001. Calcium, calcineurin, and the control of transcription., 276(4):‏ 2313‒2316.

Dijkers P F, O’Farrell P H. 2007.calcineurin promotes induction of innate immune responses., 17: 2087‒2093.

Dong Y, Chen W W, Kang K, Pang R, Dong Y P, Liu K, Zhang W Q. 2021. FoxO directly regulates the expression ofandto modulate the fecundity of the brown planthopper., 64(1): 133–143.

Fónagy A, Yokoyama N, Ozawa R, Okano K, Tatsuki S, Maeda S, Matsumoto S. 1999. Involvement of calcineurin in the signal transduction of PBAN in the silkworm,(Lepidoptera)., 124: 51‒60.

Furman J L, Norris C M. 2014. Calcineurin and glial signaling: Neuroinflammation and beyond., 11: 158.

Gajewski K, Wang J B, Molkentin J D, Chen E H, Olson E N, Schulz R A. 2003. Requirement of the calcineurin subunit genefor indirect flight muscle formation in., 100: 1040–1045.

Hou L, Cai M J, Liu W, Song Q, Zhao X F. 2012. Small GTPase Rab4b participates in the gene transcription of 20-hydroxyecdysoneand insulin pathways to regulate glycogen level and metamorphosis., 371(1): 13–22.

Hu D, Luo W, Fan L F, Liu F L, Gu J, Deng H M, Zhang C, Huang L H, Feng Q L. 2016. Dynamics and regulation of glycolysis- tricarboxylic acid metabolism in the midgut ofduring metamorphosis., 25(2): 153‒162.

Jiménez-Vidal M, Srivastava J, Putney L K, Barber D L. 2010. Nuclear-localized calcineurin homologous protein CHP1 interacts with upstream binding factor and inhibits ribosomal RNA synthesis., 285: 36260–36266.

Kayukawa T, Jouraku A, Ito Y, Shinoda T. 2017. Molecular mechanism underlying juvenile hormone-mediated repression of precocious larval-adult metamorphosis., 114: 1057–1062.

Klee C B, Ren H, Wang X T. 1998. Regulation of the calmodulin- stimulated protein phosphatase, calcineurin., 273: 13367‒13370.

Kuromi H, Yoshihara M, Kidokoro Y. 1997. An inhibitory role of calcineurin in endocytosis of synaptic vesicles at nerve terminals of., 27(2): 101‒113.

Kuwahara H, Kamei J I, Nakamura N, Matsumoto M, Inoue H, Kanazawa H. 2003. The apoptosis-inducing protein kinase DRAK2 is inhibited in a calcium-dependent manner by the calcium-binding protein CHP., 134: 245–250.

Lee J I, Mukherjee S, Yoon K H, Dwivedi M, Bandyopadhyay J. 2013. The multiple faces of calcineurin signaling in: Development, behaviour and aging., 38: 417‒431.

Li K L, Fu Q, Wang W X, Lai F X, Wan P J. 2017. Molecular cloning and functional characterization of Halloween genes involved in ecdysteroid biosynthesis in the brown planthopper,(Hemiptera: Delphacidae)., 60(10): 1129‒1140. (in Chinese with English abstract)

Li Q H, Wang L H, Lin Y N, Chang G Q, Li H W, Jin W N, Hu R H, Pang T X. 2011. Nuclear accumulation of calcineurin B homologous protein 2 (CHP2) results in enhanced proliferation of tumor cells., 16: 416–426.

Li Y B. 2016. The regulation of calcineurin to phenoloxidase and other biological enzymes involved in immunity ofL. Shenyang, China: Shenyang Agricultural University. (in Chinese with English abstract)

Li Y X, Dijkers P F. 2015. Specific calcineurin isoforms are involvedintoll immune signaling., 194(1): 168‒176.

Lin X, Sikkink R A, Rusnak F, Barber D L. 1999. Inhibition of calcineurin phosphatase activity by a calcineurin B homologous protein., 274: 36125–36131.

Livak K J, Schmittgen T D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCTmethod., 25(4): 402‒408.

Lu A R, Zhang Q L, Zhang J, Yang B, Wu K, Xie W, Luan Y X, Ling E J. 2014. Insect prophenoloxidase: The view beyond immunity., 5(1): 1‒15.

Lu F, Qi G J, Qin R R, Hu G, Wang Z, Zhang X X, Cheng X N, Zhai B P. 2011. The processes of morphological change and grading criteria for ovarian development in the brown planthopper., 48(5): 1394–1400. (in Chinese with English abstract)

Nakai Y, Horiuchi J, Tsuda M, Takeo S, Akahori S, Matsuo T, Kume K, Aigaki T. 2011. Calcineurin and its regulator sra/DSCR1 are essential for sleep in., 31: 12759–12766.

Naoe Y, Arita K, Hashimoto H, Kanazawa H, Sato M, Shimizu T. 2005. Crystallization and preliminary X-ray crystallographic analysis of rat calcineurin B homologous protein 1., F61: 612‒613.

Pang T X, Su X H, Wakabayashi S, Shigekawa M. 2001. Calcineurin homologous protein as an essential cofactor for Na+/H+exchangers., 276: 17367–17372.

Pfluger P T, Kabra D G, Aichler M, Schriever S C, Pfuhlmann K, García V C, Lehti M, Weber J, Kutschke M, Rozman J, Elrod J W, Hevener A L, Feuchtinger A, de Angelis M H, Walch A, Rollmann S M, Aronow B J, Müller T D, Perez-Tilve D, Jastroch M, de Luca M, Molkentin J D, Tschöp M H. 2015. Calcineurin links mitochondrial elongation with energy metabolism., 22: 838‒850.

Preetha G, Stanley J, Suresh S, Samiyappan R. 2010. Risk assessment of insecticides used in rice on miridbug,Reuter, the important predator of brown planthopper,(Stål)., 80: 498–503.

Riddiford L M, Hiruma K, Zhou X F, Nelson C A. 2003. Insights into the molecular basis of the hormonal control of molting and metamorphosis fromand., 33: 1327–1338.

Rider M H, Hussain N, Dilworth S M, Storey J M, Storey K B. 2011. AMP-activated protein kinase and metabolic regulation in cold-hardy insects., 57: 1453–1462.

Rusnak F, Mertz P. 2000. Calcineurin: Form and function., 80: 1483‒1521.

Shibasaki F, Hallin U, Uchino H. 2002. Calcineurin as a multifunctional regulator., 131: 1‒15.

Sugiura R, Sio S O, Shuntoh H, Kuno T. 2001. Molecular genetic analysis of the calcineurin signaling pathways., 58: 278–288.

Takeo S, Hawley R S, Aigaki T. 2010. Calcineurin and its regulation by Sra/RCAN is required for completion of meiosis in., 344(2): 957‒967.

Tomita J, Mitsuyoshi M, Ueno T, Aso Y, Tanimoto H, Nakai Y, Aigaki T, Kume S, Kume K. 2011. Pan-neuronal knockdown of calcineurin reduces sleep in the fruit fly., 31: 13137–13146.

Tonks N K. 2006. Protein tyrosine phosphatases: From genes, to function, to disease., 7: 833–846.

Tonks N K. 2013. Protein tyrosine phosphatases: From housekeeping enzymes to master regulators of signal transduction., 280: 346‒378.

Voss M, Fechner L, Walz B, Baumann O. 2010. Calcineurin activity augments cAMP/PKA-dependent activation of V-ATPase in blowfly salivary glands., 298: C1047–C1056.

Wagner J, Allman E, Taylor A, Ulmschneider K, Kovanda T, Ulmschneider B, Nehrke K, Peters M A. 2011. A calcineurin homologous protein is required for sodium-proton exchange events in theintestine., 301: C1389‒C1403.

Wang W X, Li K L, Chen Y, Lai F X, Fu Q. 2015. Identification and function analysis of enolase genefrom(Stål) (Hemiptera: Delphacidae)., 15(1): 66.

Wang Y L, Xie C S, Diao Z Q, Liang B. 2017. Calcineurin antagonizes AMPK to regulate lipolysis in., 22: 1062.

Wei J Z, Yao X, Yang S, Liu S K, Zhou S, Cen J J, Liu X G, Du M F, Tang Q B, An S H. 2021. Suppression of calcineurin enhances the toxicity of Cry1Ac to., 12: 634619.

Yamanaka N, Rewitz K F, O’Connor M B. 2013. Ecdysone control of developmental transitions: Lessons fromresearch., 58: 497–516.

Yin Z J, Dong X L, Kang K, Chen H, Dai X Y, Wu G G, Zheng L, Yu Y, Zhai Y F. 2018. FoxO transcription factor regulate hormone mediated signaling on nymphal diapause., 9: 1654.

Yoshiga T, Yokoyama N, Imai N, Ohnishi A, Moto K, Matsumoto S. 2002. cDNA cloning of calcineurin heterosubunits from the pheromone gland of the silkmoth,., 32: 477‒486.

Zhang Q, Yang J G, Chen P, Liu T H, Xiao Q, Zhou X L, Wang L, Long Y B, Dong Z Q, Pan M H, Lu C. 2020.gene regulation of the cell cycle induced by 20-hydroxyecdysone in BmN-SWU1 cells., 11(10): 700.

8 April 2021;

6 July2021

Fu Qiang (fuqiang@caas.cn); Zhu Tingheng (thzhu@zjut.edu.cn)

Copyright © 2022, China National Rice Research Institute. Hosting by Elsevier B V

This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/)

Peer review under responsibility of China National Rice Research Institute

http://dx.doi.org/10.1016/j.rsci.2022.01.003

(Managing Editor: Wu Yawen)