Expression of microRNA-29b2-c Cluster is Positively Regulated by MyoD in L6 Cells△

Chang-zheng Liu*,Jing-jing Li,Jin-mei Su,Tao Jiao,Li-juan Gou,Xiao-dong He,and Yong-sheng Chang*

1Department of Biochemistry,National Laboratory of Medical Molecular Biology,Institute of Basic Medical Sciences,Chinese Academy of Medical Sciences &Peking Union Medical College,Beijing 100005,China

2Department of General Surgery,3Department of Rheumatology,Peking Union Medical College Hospital,Chinese Academy of Medical Sciences &Peking Union Medical College,Beijing 100730,China

SKELETAL muscle precursor cells are derived from the dermomyotome during early development.These progenitors are a population of undifferentiated cells that express some vital transcription factors,namely,paired-box transcription factors Pax3 and Pax7.1,2The myogenic cell fate is determined by the Pax genes,which induce the expression of a group of basic helix-loop-helix transcription factors,referred to as the muscle regulatory factors (MRFs).2MyoD is a critical transcription factor of MRFs during the period of muscle cells maturation and myogenesis has been a leading model for clarifying the molecular mechanisms that underlie tissue differentiation and development since the discovery of myoD.3Weintraub’s group cloned MyoDgene through subtractive hybridization from azacytidine-treated myoblasts and they demonstrated that myoDalone was enough to convert 10T1/2 fibroblasts into myoblasts.4MyoD binds the E-box sequence (CANNTG)in the promoters of its target genes,thereby driving the transcription of muscle-related genes and promoting myogenesis.5

As the progress in the genetics research of skeletal muscle lineage commitment,many novel molecules exert crucial functions in myogenesis,such as microRNAs (miRs).6miRs are small,20-to 24-nucleotide non-coding RNAs found in diverse organisms.7They play important roles in multiple biological processes such as development,differentiation,and cellular stress response.8-10Chenet al11reported that miR-1 and miR-133 had distinct roles in modulating skeletal muscle proliferation and differentiation by targeting histone deacetylase 4 and serum response factor,respectively.miR-206 was another muscle-specific miR which promoted skeletal muscle development.12,13Studies indicated that miR-29 family plays critical roles in carcinogenesis and hepatic glucose metabolism.14,15In fact,this miR family was also important regulators of myogenesis.miR-29 family is consisted of three members,miR-29a,b,and c and mapped to different chromosome as two clusters,miR-29b1-a and miR-29b2-c.We demonstrated that miR-29 family suppressed glucose uptake induced by insulin in L6 myotubes (unpublished data) and 3T3-L1 adipocytes.16Moreover,we noted that the expression of miR-29a,miR-29b,and miR-29c was up-regulated in L6 myotubes compared with L6 myoblasts and the levels of miR-29b and miR-29c were elevated in L6 myotubes treated by insulin and glucose,accompanied with increased myoD levles.A few questions remain unanswered.For example,is the expression of miR-29 regulated by myoD?If that,is the regulatory effect of myoD direct? And whether the expression of miR-29b1-a cluster and miR-29b2-c cluster is both regulated by myoD? Herein,we investigated the regulatory impact of myoD on miR-29b2-c expression by using dual luciferase reporter gene assay,electrophoretic mobility shift assay (EMSA),and northern blots.

MATERIALS AND METHODS

Cell lines,cell culture and treatment

293A and L6 cells were conserved in our lab and grown in α-MEM (GIBCO,USA) with 10% fetal bovine serum (FBS,Hyclone,USA) at 37°C in 5% CO2cell culture incubator.To differentiate L6 myoblast cells into myotubes,cells were grown to confluency and the medium was then changed to α-MEM containing 2% FBS and 25 mg/mL amphotericin B(Promega,USA).Cells were then maintained in α-MEM containing 2% FBS and 25 mg/mL amphotericin B for 4-8 days to be differentiated into myotubes.L6 myotube cells were treated with glucose (25 mmol/L) and insulin (100 nmol/L) for 48-72 hours before gene expression analysis was conducted.

RNA isolation and real-time PCR

Total RNA was extracted from cells by using Trizol reagent(Invitrogen,USA).Real-time PCR of miRs was performed as the protocol supplied by Applied Biosystems,USA.Real-time RT-PCR analysis was conducted to detect the expression of Rno-myoD (forward∶5´-TACCCAAGGTGGAGATCCTG-3´,reverse∶5´-ATCATGCCATCAGAGCAGT-3´),GAPDH(forward∶5´-GCACCACCAACTGCTTAG-3´,reverse∶5´-GATGCAGGGATGATGTTC-3´),miR-29a (RT primer∶5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAACCG-3′;PCR primers∶forward,5′-TGCGCTAGCACATCTGAAAT-3′,reverse,5′-GTGCAGGGTCCGAGGT-3′),miR-29b (RT primer∶5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACACTG-3′;PCR primers∶forward,5′-CTGGAGTAGCACCATTTGAAAT-3′,reverse,5′-GTGCAGGGTCCGAGGT-3′),miR-29c (RT primer∶5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAACCG-3′;PCR primers∶forward,5′-CTGGAGTAGCACCATTTGAAAT-3′,reverse,5′-GTGCAGGGTCCGAGGT-3′),and U6 snRNA (RT primer∶5′-AAAATATGGAACGCTTCACGAATTTG-3′;PCR primers∶forward,5′-CTCGCTTCGGCAGCACATATACT-3′,reverse,5′-ACGCTTCACGAATTTGCGTGTC-3′).

For these analyses,1 μg of total RNA from the cell lines was converted to cDNA using SUPERSCRIPTTMⅢ First-Strand Synthesis System for RT-PCR (Invitrogen) with the following incubations∶65°C for 5 minutes;0°C for 1 minute;50°C for 50 minutes;85°C for 5 minutes.Following cDNA synthesis,quantitative RT-PCR was performed on the ABI Prism 7500HT Sequence Detection System using SYBR®Green PCR Master Mix (Applied Biosystems,) with the following cycling conditions∶95°C for 10 minutes (initial denaturation),then 40 cycles of 95°C for 15 seconds,and 60°C for 60 seconds.

Western blot

Western blot analysis was performed as previously described10and the membranes were blotted with antibodies for 2 hours at room temperature for myoD and GAPDH (rabbit polyclonal antibody to GAPDH from Santa Cruz,USA,used in 1/2000 dilution;rabbit polyclonal antibody to myoD from CST,USA,used in 1/1000 dilution).The membranes were incubated with the secondary antibody linked with horseradish peroxidase(HRP) against rabbit (1/5000 dilution;Santa Cruz) for 1 hour.Exposure was performed by using Chemiluminescent Western Blotting Kits (Pierce,USA).The signal was quantified by Kodak Imaging software and the ratio of myoD to GAPDH was determined.

Northern blot

RNA extraction was conducted as described above and Northern blot was performed as described before.10An aliquot of 10-30 μg of total RNA was separated on 15%denaturing polyacrylamide gels and electrotransferred to Hybond N+membrane (Amersham Biosciences,Little Chalfont,UK).The membranes were UV cross-linked with samples facing upward,prehybridized for 1 hour,and then subjected to overnight hybridization with 5’-32P-endlabeled oligonucleotide probes (miR-29a∶TAACCGATTTCAGATGGTGCTA,miR-29b∶TAACCGATTTCAGATGGTGCTA,miR-29c∶TAACCGATTTCAGATGGTGCTA,U6 snRNA∶GAGACAGGAAAAAACGCTTCACGAATTTGCGT) at 37°C.The membranes were rinsed twice with 1×standard sodium citrate (SSC)plus 0.1% sodium dodecyl sulfate (SDS) at room temperature,extensively washed in 0.5×SSC plus 0.1% SDS at 37°C,and then exposed to Kodak Biomax MS X-ray film at -80°C(Eastman Kodak,Rochester,NY,USA).To strip off probes from the hybridized membranes for their reuse,they were incubated in 0.5% SDS at 100°C for 5 minutes,washed in 2×SSC for 5 minutes,and rehybridized.

Plasmid construction and luciferase gene assay

The potential promoter and transcription factors binding sites of miR-29 clusters were predicted by Promoter scan and transcriptional factor search.The promoter region of Rno-miR-29b1-a and Rno-miR-29b2-c cluster containing myoD consensus target sequence was cloned into pGL3-promoter plasmid (Promega,USA) to get P-miR-29b1-a and P-miR-29b2-c,respectively.Primers sequences were shown as follow,P-miR-29b1-a∶(forward) 5´-GAGCTCGCTGAAGGGCCTC-3´,(reverse) 5´-GCTAGCCTCCTATGCTGGCC-3´;P-miR-29b2-c∶(forward) 5´-GTTACCGGGAGGCAGGGTGTGCCC-3´,(reverse) 5´-CCCGGGCCTGTATGACTTCACATT-3´.293A cells were seeded onto 24-well plates (1×105cells per well)the day before transfections.Cells were transfected with pRL-TK luciferase reporters,pGL-3-P-miR-29b2-c firefly luciferase and pEGFP-C1-myoD or small interfering RNA(siRNA)-myoD.All transfections were carried out in triplicate using Effectene (QIAGEN,Germany).Cell lysates were prepared and luciferase activities were measured using the Dual Luciferase Reporter Assay (Promega).

EMSA

For EMSA,nuclear extracts were prepared from L6 cells.Probes were generated by annealing single-strand oligonucleotides containing the myoD consensus sequence of miR-29b2-c promoter and labeling the ends with [γ-32P]ATP using T4 polynucleotide kinase (TaKaRa Bio.,Japan).The oligonucleotides of myoD binding sequence were shown as follow∶wild-type,(forward) 5´-CTAGGAGGACCAAAAGAAACAGGTGTTTTCTAAATGATA-3´,(reverse) 5´-CTAGTATCATTTAGAAAACACCTGTTTCTTTTGGTCCTC-3´;mutant,(forward) 5´-CTAGCCCTTGGAACATCTGTCGATGCTG-3´,(reverse) 5´-CTAGCAGCATCGACAGATGTTCCAAGGG-3´.EMSA was performed with 1 mg of nuclear extract in binding buffer (20 mmol/L Hepes,pH 7.9,0.05 mmol/L EDTA,pH 8.0,50 mmol/L KCl,1 mmol/L MgCl2,0.5 mmol/L dithiothreitol and 5% glycerol)containing 1 mg of poly (deoxyinosinicdeoxycytidylic) acid.A total of 1 mg anti-myoD antibody (CST) immunoglobulin G or 5-or 10-fold competitors were incubated with nuclear extracts on ice for 30 minutes before probes were added into the binding buffer.Samples were incubated on ice for 1 hour and then separated by electrophoresis on 6%non-denaturing polyacrylamide gel,and then the gel was dried and subjected to autoradiography.

Preparation of expression plasmids and recombinant adenoviruses

The full-length rat myoD gene was amplified by PCR from L6 cells cDNA and then cloned into pAd track CMV vector using the following PCR primer pairs∶5′-TCTAGAATGGAGCTACTATCGCCGC-3′ (forward) and 5′-GGTACCTCAGAGCACCTGGTAAATCGG-3′ (reverse).Recombinant adenoviruses expressing myoD were generated as previously described.17

Statistical analysis

Microsoft Excel software was used for statistical analysis.Student'sttest (two-tailed) was performed to compare two groups unless otherwise indicated (χ2-test).P＜0.05 was considered as significant.

RESULTS

Expression of myoD is up-regulated in L6 myotubes treated by glucose and insulin

The protein levels of myoD were increased in L6 myotubes compared with myoblasts (Fig.1A).We also observed an augment of myoD protein in L6 myotubes with glucose and insulin treatment (Fig.1A).Real-time PCR analysis indicated that the mRNA of myoD was also elevated in L6 myotubes differentiated from myoblasts and L6 myotubes treated by glucose and insulin (Fig.1B).

Expression levels of miR-29 family are elevated in L6 myotubes treated by glucose and insulin

Northern blot analysis demonstrated that the expression of miR-29a,miR-29b,and miR-29c was up-regulated in L6 myotubes differentiated from myoblasts (Fig.2A).MiR-29b and miR-29c depicted significant up-regulation in L6 myotubes with glucose and insulin treatment and we noted no obvious difference in miR-29a expression (Fig.2A).Similar results were observed shown by real-time PCR analysis (Fig.2B).

Expression of miR-29b2-c cluster is positively regulated by myoD

As stated above,myoD and miR-29 family shared same expression profile in L6 cells and since myoD was an important transcription factor in myogenesis.We asked whether the expression of miR-29 family (miR-29b1-a and miR-29b2-c clusters) was regulated by myoD directly.We firstly performed bioinformatics analysis on the promoter regions of miR-29b1-a cluster and miR-29b2-c cluster by using transcriptional factor search.Several conserved myoD binding sites were mapped to the promoter region of miR-29b1-a and miR-29b2-c cluster.Secondly,we generated a fly luciferase plasmid containing myoD binding sites in the promoter region of miR-29b1-a and miR-29b2-c cluster.Dual-luciferase reporter gene assay was performed,which revealed myoD-dependent activation and knock-down of myoD by using siRNA led to a decrease in luciferase activities of PmiR-29b2-c (Fig.3A).No obvious change was observed in the luciferase activities of PmiR-29b1-a (data not shown).We further conducted EMSA to assess the binding of myoD on specific sequence,which demonstrated that myoD could bind at the promoter region of miR-29b2-c cluster (Fig.3B).These data suggest that myoD is a positive regulator of miR-29b2-c expression.

Figure 1.Expression of myoD is up-regulated in L6 myotubes with glucose and insulin treatment.

Figure 2.Expression of microRNA-29 (miR-29) family is up-regulated in L6 myotubes with glucose and insulin treatment.

Figure 3.Expression of miR-29b2-c cluster is positively regulated by myoD.

Ectopic expression of myoD results in an increase of endogenous miR-29b and miR-29c levels

To further probe the regulatory effect of myoD on endogenous miR-29b and miR-29c expression,we generated recombinant adenovirus expressing myoD (Ad-myoD) in L6 cells (Fig.4A)and tested whether enforced expression of myoD could induce an increase of endogenous miR-29b and miR-29c levels.Northern blot analysis indicated that Ad-myoD led to a marked elevation of miR-29b and miR-29c expression in L6 cells compared with Ad-GFP-treated cells (Fig.4B).Similar results were observed in L6 cells by using real-time PCR analysis (Figs.4C-E).Collectively,myoD can induce miR-29b and miR-29c expression in L6 cells.

Figure 4.Overexpression of myoD results in an augment of miR-29b and miR-29c expression.

DISCUSSION

The genetics of skeletal muscle lineage commitment were complicated and the discovery of myoD in 1986 shed new light on the molecular nature of skeletal muscle differentiation.3,4MyoD was cloned by Weintraub’s group through subtractive hybridization from azacytidine-treated myoblasts and they also demonstrated that myoD alone was enough to convert 10T1/2 fibroblasts into myoblasts.4MyoD binds the E-box sequence (CANNTG) in the promoters of downstream muscle-related genes in collaboration with myocyte enhancer factor 2 (Mef2).5One study showed that a few target proteins were regulated by myoD in myogenesis.5In this study,we demonstrated that a noncoding RNA family (miR-29b2-c cluster) was a downstream target of myoD in L6 cells.miR-29 family was consisted of two clusters,namely miR-29b1-a and miR-29b2-c,which were mapped to chromosome 4 and 13 of rattus norvegicus,respectively.Firstly,we conducted bioinformatics analysis by using promoter scan on 3 kb sequence upstream of miR-29b1-a and miR-29b2-c.No potential promoter was found in the upstream sequence of miR-29b1-a.However,we noted a potential promoter of miR-29b2-c and we also found a potential binding site of myoD in the predicted promoter region by transcriptional factor search.Secondly,dual-luciferase reporter gene assay was performed to probe the regulatory function of myoD,which indicated that myoD was a positive regulator of miR-29b2-c expression.Thirdly,we conducted EMSA to confirm the binding of myoD with specific sequence upstream of miR-29b2-c.Taken together,these data suggest myoD could bind at the promoter region of miR-29b2-c and evoke its transcription.However,further studies should be performed to validate whether the predicted promoter was undoubted.

Recent studies demonstrated that miR-29a,miR-29b,and miR-29c were tumor-related miRNAs in multiple cancers.18-20In fact,this miRNA family was also critical regulator of glucose metabolism and exerted distinct function in muscle,adipocytes,and liver.We previously reported restoration of miR-29 in 3T3-L1 adipocytes suppressed glucose uptake induced by insulin.16This finding was also validated in rat skeletal muscle cells (L6)(unpublished data).But we observed that enforced expression of miR-29 in mouse liver resulted in a marked improvement of diabetic phenotypes.15These data provided multiple roles of miR-29 in biological processes.Since the discovery of myoD promoted the elucidating of the molecular mechanisms of myogenesis and miR-29b2-c cluster was a target of myoD,we deduced that myoD might play vital role in regulating glucose metabolism.Of course,further work should be conducted to test this idea.Altogether,our results provide a regulatory model of myoDmiR-29 in L6 cell differentiation and glucose uptake and this regulatory network maybe a target of diabetes therapy.

1.Relaix F,Montarras D,Zaffran S,et al.Pax3 and Pax7 have distinct and overlapping functions in adult muscle progenitor cells.J Cell Biol 2006;172∶91-102.

2.Gagan J,Dey BK,Dutta A.MicroRNAs regulate and provide robustness to the myogenic transcriptional network.Curr Opin Pharmacol 2012;12∶383-8.

3.Yokoyama S,Asahara H.The myogenic transcriptional network.Cell Mol Life Sci 2011;68∶1843-9.

4.Davis RL,Weintraub H,Lassar AB.Expression of a single transfected cDNA converts fibroblasts to myoblasts.Cell 1987;51∶987-1000.

5.Puri PL,Sartorelli V.Regulation of muscle regulatory factors by DNA-binding,interacting proteins,and post-transcriptional modifications.J Cell Physiol 2000;185∶155-73.

6.Yu XK,Zuo Q.MicroRNAs in the regeneration of skeletal muscle.Front Biosci 2013;18∶608-15.

7.Ambros V.The functions of animal microRNAs.Nature 2004;431∶350-5.

8.Hornstein E,Mansfield JH,Yekta S,et al.The microRNA miR-196 acts upstream of Hoxb8 and Shh in limb development.Nature 2005;438∶671-4.

9.Zhao Y,Samal E,Srivastava D.Serum response factor regulates a muscle-specific microRNA that targets Hand2 during cardiogenesis.Nature 2005;436∶214-20.

10.Liu C,Yu J,Yu S,et al.MicroRNA-21 acts as an oncomir through multiple targets in human hepatocellular carcinoma.J Hepatol 2010;53∶98-107.

11.Chen JF,Mandel EM,Thomson JM,et al.The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation.Nat Genet 2006;38∶228-33.

12.Anderson C,Catoe H,Werner R.MIR-206 regulates connexin43 expression during skeletal muscle development.Nucleic Acids Res 2006;34∶5863-71.

13.Kim HK,Lee YS,Sivaprasad U,et al.Muscle-specific microRNA miR-206 promotes muscle differentiation.J Cell Biol 2006;174∶677-87.

14.Wang H,Garzon R,Sun H,et al.NF-kappaB-YY1-miR-29 regulatory circuitry in skeletal myogenesis and rhabdomyosarcoma.Cancer Cell 2008;14∶369-81.

15.Liang J,Liu C,Qiao A,et al.MicroRNA-29a-c decrease fasting blood glucose levels by negatively regulating hepatic gluconeogenesis.J Hepatol 2013;58∶535-42.

16.He A,Zhu L,Gupta N,et al.Overexpression of micro ribonucleic acid 29,highly up-regulated in diabetic rats,leads to insulin resistance in 3T3-L1 adipocytes.Mol Endocrinol 2007;21∶2785-94.

17.Luo J,Deng ZL,Luo X,et al.A protocol for rapid generation of recombinant adenoviruses using the AdEasy system.Nat Protoc 2007;2∶1236-47.

18.Fabbri M,Garzon R,Cimmino A,et al.MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B.Proc Natl Acad Sci USA 2007;4∶5805-10.

19.Braconi C,Kogure T,Valeri N,et al.microRNA-29 can regulate expression of the long non-coding RNA gene MEG3 in hepatocellular cancer.Oncogene 2011;30∶4750-6.

20.Xiong Y,Fang JH,Yun JP,et al.Effects of microRNA-29 on apoptosis,tumorigenicity,and prognosis of hepatocellular carcinoma.Hepatology 2010;51∶836-45.